WormBase Tree Display for Variation: WBVar00093583
expand all nodes | collapse all nodes | view schema
WBVar00093583 | Evidence | Paper_evidence | WBPaper00040857 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | ok2435 | |||||
HGVSg | CHROMOSOME_III:g.5017932_5019475del | ||||||
Sequence_details | SMap | S_parent | Sequence | R144 | |||
Flanking_sequences | aaataagacggtaaagaattttatcagaat | tcagttccaagctcaaaaccgactccacct | |||||
Mapping_target | R144 | ||||||
Type_of_mutation | Deletion | ||||||
PCR_product | ok2435_external | ||||||
ok2435_internal | |||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00037056 | ||||||
Laboratory | RB | ||||||
Person | WBPerson46 | ||||||
KO_consortium_allele | |||||||
Status | Live | ||||||
Affects | Gene | WBGene00020094 | |||||
Transcript | R144.4a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||
VEP_impact | HIGH | ||||||
cDNA_position | ?-495 | ||||||
CDS_position | ?-492 | ||||||
Protein_position | ?-164 | ||||||
Intron_number | 2-4/9 | ||||||
Exon_number | 1-5/10 | ||||||
R144.4b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | ||||||
cDNA_position | ?-501 | ||||||
CDS_position | ?-492 | ||||||
Protein_position | ?-164 | ||||||
Intron_number | 2-4/9 | ||||||
Exon_number | 1-5/10 | ||||||
Isolation | Mutagen | EMS | |||||
Description | Phenotype_not_observed | WBPhenotype:0000436 | Paper_evidence | WBPaper00040857 | |||
Curator_confirmed | WBPerson712 | ||||||
Remark | Mutants showed normal localization of SNB-1::VENUS in the RIA neuron. | Paper_evidence | WBPaper00040857 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00040857 | ||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||
Method | KO_consortium_allele |