WormBase Tree Display for Variation: WBVar00093499
expand all nodes | collapse all nodes | view schema
WBVar00093499 | Name | Public_name | ok2346 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | F39B1.1.1:c.1983+11_3178-14del | |||||||
HGVSg | CHROMOSOME_X:g.15239181_15240777del | |||||||
Sequence_details | SMap | S_parent | Sequence | F39B1 | ||||
Flanking_sequences | cgcatgtcatcgtcacgctggaaagcatca | taacacttacataaaggtccaatggaatcc | ||||||
Mapping_target | F39B1 | |||||||
Type_of_mutation | Deletion | |||||||
PCR_product | ok2346_external | |||||||
ok2346_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00032504 | |||||||
Laboratory | RB | |||||||
Person | WBPerson46 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00009552 | ||||||
Transcript | F39B1.1.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | F39B1.1.1:c.1983+11_3178-14del | |||||||
Intron_number | 12-15/24 | |||||||
Exon_number | 13-15/25 | |||||||
Interactor (25) | ||||||||
Isolation | Mutagen | EMS | ||||||
Description | Phenotype | WBPhenotype:0000241 | Paper_evidence | WBPaper00035284 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Mutations resulted in the accumulation of cell corpses at several embryonic stages | Paper_evidence | WBPaper00035284 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000243 | Paper_evidence | WBPaper00044390 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | The piki-1(ok2346) mutation resulted in a significant increase in the duration time of cell corpses observed in embryos (Figure S1D) | Paper_evidence | WBPaper00044390 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0000679 | Paper_evidence | WBPaper00044390 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Cell corpse phagosomal labeling by the lysosomal membrane marker LAAT-1::mCHERRY was reduced in piki-1(ok2346) mutants (Figure 2G). | Paper_evidence | WBPaper00044390 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Authors found that cell corpse phagosomal association of GFP-RAB-5, which is recruited at early phagosome maturation stages, decreased significantly in piki-1(ok2346) mutants (Figure 2E). | Paper_evidence | WBPaper00044390 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Authors found that cell corpse phagosomal association of GFP-RAB-7, which is recruited at late phagosome maturation stages, decreased significantly in piki-1(ok2346) mutants (Figure 2F). | Paper_evidence | WBPaper00044390 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | LAAT-1-mCHERRY | Paper_evidence | WBPaper00044390 | ||||
Curator_confirmed | WBPerson2987 | |||||||
GFP-RAB-5 | Paper_evidence | WBPaper00044390 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
GFP-RAB-7 | Paper_evidence | WBPaper00044390 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001180 | Paper_evidence | WBPaper00048406 | ||||||
Curator_confirmed | WBPerson17560 | |||||||
Remark | Table S1 | Paper_evidence | WBPaper00048406 | |||||
Curator_confirmed | WBPerson17560 | |||||||
WBPhenotype:0001181 | Paper_evidence | WBPaper00044390 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | The piki-1(ok2346) mutation resulted in a significant increase in the number of cell corpses observed in 1.5f stage embryos (Figure 2I) | Paper_evidence | WBPaper00044390 | |||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001846 | Paper_evidence | WBPaper00044390 | ||||||
WBPaper00048406 | ||||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPerson17560 | ||||||||
Remark | Authors found that cell corpse phagosomal association of GFP-RAB-5, which is recruited at early phagosome maturation stages, decreased significantly in piki-1(ok2346) mutants (Figure 2E). | Paper_evidence | WBPaper00044390 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Authors found that cell corpse phagosomal association of GFP-RAB-7, which is recruited at late phagosome maturation stages, decreased significantly in piki-1(ok2346) mutants (Figure 2F). | Paper_evidence | WBPaper00044390 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Cell corpse phagosomal labeling by the lysosomal membrane marker LAAT-1::mCHERRY was reduced in piki-1(ok2346) mutants (Figure 2G). | Paper_evidence | WBPaper00044390 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
piki-1(ok2346) mutants exhibited a significant delay in the recruitment of phosphatidylinositol 3-phosphate (PI3P) to corpse-engulfing phagosomes, as determined by the PI3P marker YFP-2xFYVE (Figure 3C,H S3C,D) | Paper_evidence | WBPaper00044390 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
"As previously reported (Lu et_al, 2012), loss of piki-1, which affects PtdIns3P generation, abolished phagosomal association of LST-4, suggesting that PtdIns3P is important for recruiting LST-4 to phagosomes (Fig 6 D)." | Paper_evidence | WBPaper00048406 | ||||||
Curator_confirmed | WBPerson17560 | |||||||
Phenotype_assay | Genotype | GFP-RAB-5 | Paper_evidence | WBPaper00044390 | ||||
Curator_confirmed | WBPerson2987 | |||||||
GFP-RAB-7 | Paper_evidence | WBPaper00044390 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
LAAT-1-mCHERRY | Paper_evidence | WBPaper00044390 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
YFP-2xFYVE, a marker for phosphatidylinositol 3-phosphate | Paper_evidence | WBPaper00044390 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002349 | Paper_evidence | WBPaper00044390 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Authors found significantly reduced YFP-2xFYVE labeling of cell corpses in piki-1(ok2346) mutants, suggesting that phosphatidylinositol 3-phosphate (PtdIns3P) generation and/or accumulation on phagosomes is affected (Figure 2C, D). | Paper_evidence | WBPaper00044390 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | YFP-2xFYVE, a marker for phosphatidylinositol 3-phosphate | Paper_evidence | WBPaper00044390 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0002394 | Paper_evidence | WBPaper00048406 | ||||||
Curator_confirmed | WBPerson17560 | |||||||
Remark | Figure 3, unsealed phagosomes can be labeled by PLCδ1-PH and the membrane impermeable dye FM4-64. Loss of mtm-1, piki-1, lst-4, dyn-1 or ocrl-1 shows phagosome sealing defective; "As in mtm-1(lf), persistent phagosomes in piki-1 or piki-1;vps-34 RNAi worms were labeled by both FM4-64 and PLCδ1-PH, indicating that phagosomal sealing is defective (Fig 3, H-I'', L, and M; and Fig S3, F-F''', H, and I)." | Paper_evidence | WBPaper00048406 | |||||
Curator_confirmed | WBPerson17560 | |||||||
Phenotype_not_observed | WBPhenotype:0000436 | Paper_evidence | WBPaper00035284 | |||||
WBPaper00040857 | ||||||||
Curator_confirmed | WBPerson2021 | |||||||
WBPerson712 | ||||||||
Remark | The plasma membrane localization of MTM-1 was not obviously affected in piki-1(ok2346) mutants | Paper_evidence | WBPaper00035284 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Mutation did not cause SNB-1::VENUS localization defects. | Paper_evidence | WBPaper00040857 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000736 | Paper_evidence | WBPaper00044390 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | The piki-1(ok2346) mutation did not cause autophagy defects, as determined by antibody staining for LGG-1 and SEPA-1 (Figure S4) | Paper_evidence | WBPaper00044390 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Authors examined phosphatidylinositol 3-phosphate (PtdIns3P) on autophagic structures by quantifying the percentage of LGG-1 puncta that were positive for YFP-2xFYVE. In wild-type embryos, very few LGG-1 puncta (17%) were positive for YFP-2xFYVE (Fig. 4A and E). Authors found that loss of piki-1 did not significantly reduce PtdIns3P on LGG-1 puncta in epg-6(bp242) embryos, suggesting that piki-1 is not required for producing PtdIns3P on autophagic structures (Fig. 4C-E). | Paper_evidence | WBPaper00044390 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | epg-6(bp242) | Paper_evidence | WBPaper00044390 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001346 | Paper_evidence | WBPaper00044390 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Actin ring formation on corpse-engulfing phagosomes was not affected by the piki-1(ok2346) mutation (Figure S3A,B) | Paper_evidence | WBPaper00044390 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | GFP-ACT-1 | Paper_evidence | WBPaper00044390 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001846 | Paper_evidence | WBPaper00044390 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Actin ring formation on corpse-engulfing phagosomes was not affected by the piki-1(ok2346) mutation (Figure S3A,B) | Paper_evidence | WBPaper00044390 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | GFP-ACT-1 | Paper_evidence | WBPaper00044390 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Reference | WBPaper00040857 | |||||||
WBPaper00035284 | ||||||||
WBPaper00044390 | ||||||||
WBPaper00048406 | ||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
Method | KO_consortium_allele |