WormBase Tree Display for Variation: WBVar00093115
expand all nodes | collapse all nodes | view schema
WBVar00093115 | Name | Public_name | ok1920 | ||
---|---|---|---|---|---|
HGVSg | CHROMOSOME_IV:g.9108238_9109684del | ||||
Sequence_details | SMap | S_parent | Sequence | C01F6 | |
Flanking_sequences | tcgatctatatgcattaattcattctatca | attttacttgtttgttctcatgttttcata | |||
Mapping_target | C01F6 | ||||
Type_of_mutation | Deletion | ||||
PCR_product | OK1920_external | ||||
OK1920_internal | |||||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00032271 | ||||
Laboratory | RB | ||||
Person | WBPerson46 | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00000120 | |||
Transcript | C01F6.5.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,3_prime_UTR_variant,intron_variant | ||
VEP_impact | HIGH | ||||
cDNA_position | ?-705 | ||||
Intron_number | 2/3 | ||||
Exon_number | 1-4/4 | ||||
Isolation | Mutagen | UV/TMP | |||
Reference | WBPaper00061052 | ||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||
Created by WBPerson51134 from the NN_VFP_triage_pipeline | |||||
Variation stub/paper connection generated from the May 2021 NN VFP dataset. | |||||
Method | KO_consortium_allele |