WormBase Tree Display for Variation: WBVar00092782
expand all nodes | collapse all nodes | view schema
WBVar00092782 | Evidence | Paper_evidence | WBPaper00031230 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | ok1573 | ||||||
HGVSg | CHROMOSOME_IV:g.9682216_9683114del | |||||||
Sequence_details | SMap | S_parent | Sequence | ZK1251 | ||||
Flanking_sequences | gattcgcatgcttttccacaaaccgcaaac | cttatcaagcagttgtgcggtttcttgatc | ||||||
Mapping_target | ZK1251 | |||||||
Type_of_mutation | Deletion | |||||||
PCR_product | ok1573_external | |||||||
ok1573_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00032086 | |||||||
Laboratory | RB | |||||||
Person | WBPerson46 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00002090 | ||||||
WBGene00189968 | ||||||||
WBGene00014240 | ||||||||
Transcript | ZK1251.2b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
cDNA_position | ?-258 | |||||||
CDS_position | ?-239 | |||||||
Protein_position | ?-80 | |||||||
Intron_number | 2/4 | |||||||
Exon_number | 1-3/5 | |||||||
ZK1251.14 | VEP_consequence | transcript_ablation | ||||||
VEP_impact | HIGH | |||||||
Exon_number | 1/1 | |||||||
ZK1251.2a.1 | VEP_consequence | coding_sequence_variant,5_prime_UTR_variant | ||||||
VEP_impact | MODIFIER | |||||||
cDNA_position | ?-206 | |||||||
CDS_position | ?-206 | |||||||
Protein_position | ?-69 | |||||||
Exon_number | 1/3 | |||||||
ZK1251.1.1 | VEP_consequence | coding_sequence_variant,3_prime_UTR_variant | ||||||
VEP_impact | MODIFIER | |||||||
cDNA_position | 352-? | |||||||
CDS_position | 340-? | |||||||
Protein_position | 114-? | |||||||
Exon_number | 3-4/4 | |||||||
Isolation | Mutagen | UV/TMP | ||||||
Description | Phenotype | WBPhenotype:0000061 | Paper_evidence | WBPaper00031230 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Mean lifespan is extended (21.4 0.7 (n = 124/186), P < 0.0001) compared to N2 (14.3 0.3 (n = 176/215; events/total)). | Paper_evidence | WBPaper00031230 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Strain was outcrossed 3 times to N2 before testing. | Paper_evidence | WBPaper00031230 | ||||
Curator_confirmed | WBPerson712 | |||||||
Temperature | 20C | Paper_evidence | WBPaper00031230 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00031230 | |||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||
Method | KO_consortium_allele |