WormBase Tree Display for Variation: WBVar00092631

WBVar00092631 Name: Public_name: ok1416
    Other_name: C30B5.1.1:c.363+10_1541del
    HGVSg: CHROMOSOME_II:g.6199257_6200630del
  Sequence_details: SMap: S_parent: Sequence: C30B5
    Flanking_sequences: TCGATAATTGCGAAGTGGAAGTGCGAGGAATTAAATATAGAGTGCGATCT GTGAGATCTTGTATGCAAGTTCTTAAAAACATTATTAAATGTTTCAGGTC
    Mapping_target: C30B5
    Type_of_mutation: Deletion
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00036251
    Laboratory: RB
    Person: WBPerson46
    KO_consortium_allele
    Status: Live: Curator_confirmed: WBPerson4025
  Affects: Gene: WBGene00077732
    Transcript: C30B5.1.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: C30B5.1.1:c.363+10_1541del
        cDNA_position: ?-1635
        CDS_position: ?-1541
        Protein_position: ?-514
        Intron_number: 4-7/10
        Exon_number: 5-8/11
  Isolation: Mutagen: EMS
  Remark: This was suppressed because it overlapped with a corrected genome sequence error feature Feature_evidence: WBsf122098
    This was un-suppressed after examination showed it is not changed by the corrected genome sequence error Curator_confirmed: WBPerson4025
    Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele