WormBase Tree Display for Variation: WBVar00092196

WBVar00092196 Name: Public_name: ok925
    Other_name: K08E3.4.1:c.904_*70del
    HGVSg: CHROMOSOME_III:g.13759551_13760696del
  Sequence_details: SMap: S_parent: Sequence: K08E3
    Flanking_sequences: gtgggagaatgggaggcaccgcggattgtt tgttggcttgtacaccgatgtgaccttatc
    Mapping_target: K08E3
    Type_of_mutation: Deletion
    PCR_product: ok925_external
      ok925_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00031713
    Laboratory: RB
    Person: WBPerson46
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00010664
    Transcript: K08E3.4.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,stop_lost,3_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: K08E3.4.1:c.904_*70del
        cDNA_position: 904-2002
        CDS_position: 904-?
        Protein_position: 302-?
        Intron_number: 5/6
        Exon_number: 5-7/7
  Isolation: Mutagen: UV/TMP
  Description: Phenotype: WBPhenotype:0000153 Paper_evidence: WBPaper00046990
        Curator_confirmed: WBPerson557
        Remark: In dbn-1 (ok925) mutant animals there is a mild disorganization/depolymerization of actin filaments (F-actin) during body wall muscle contraction. Paper_evidence: WBPaper00046990
            Curator_confirmed: WBPerson557
          GFP-UNC-60B was abnormally accumulated along I-bands in the contracted state of body wall muscles in the dbn-1 (ok925) mutant compared with the regular pattern in wild-type worms Paper_evidence: WBPaper00046990
            Curator_confirmed: WBPerson557
        Phenotype_assay: Genotype: GFP-ACT-2 Paper_evidence: WBPaper00046990
              Curator_confirmed: WBPerson557
            GFP-UNC-60B Paper_evidence: WBPaper00046990
              Curator_confirmed: WBPerson557
      WBPhenotype:0000611 Paper_evidence: WBPaper00046990
        Curator_confirmed: WBPerson557
        Remark: In dbn-1 (ok925) mutants, a significant amount of GFP-LEV-11 appeared at I-bands in relaxed body wall muscles. Paper_evidence: WBPaper00046990
            Curator_confirmed: WBPerson557
          In dbn-1 (ok925) mutants, irregular patterns of alpha-actinin accumulations were observed in the relaxed state which became even more dramatic during contraction in body wall muscles. Paper_evidence: WBPaper00046990
            Curator_confirmed: WBPerson557
        Phenotype_assay: Genotype: GFP-LEV-11 Paper_evidence: WBPaper00046990
              Curator_confirmed: WBPerson557
            GFP-ATN-1 Paper_evidence: WBPaper00046990
              Curator_confirmed: WBPerson557
  Reference: WBPaper00046990
  Remark: Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele