WormBase Tree Display for Variation: WBVar00092175
expand all nodes | collapse all nodes | view schema
| WBVar00092175 | Name | Public_name | ok902 | ||||
|---|---|---|---|---|---|---|---|
| HGVSg | CHROMOSOME_I:g.5620093_5621792del | ||||||
| Sequence_details | SMap | S_parent | Sequence | F46F11 | |||
| Flanking_sequences | atgtcattggatcgaggtgagggtttatat | gctccccttttcgtggggcctcgcaaaaaa | |||||
| Mapping_target | F46F11 | ||||||
| Type_of_mutation | Deletion | ||||||
| PCR_product | ok902_external | ||||||
| ok902_internal | |||||||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00031328 | ||||||
| WBStrain00031698 | |||||||
| Laboratory | RB | ||||||
| Person | WBPerson46 | ||||||
| KO_consortium_allele | |||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00018510 | |||||
| WBGene00000473 | |||||||
| Transcript | F46F11.2.1 | VEP_consequence | splice_acceptor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | ||||
| VEP_impact | HIGH | ||||||
| Intron_number | 3/4 | ||||||
| Exon_number | 4-5/5 | ||||||
| F46F11.7.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||
| VEP_impact | HIGH | ||||||
| Intron_number | 2-5/10 | ||||||
| Exon_number | 1-5/11 | ||||||
| Interactor | WBInteraction000009134 | ||||||
| Isolation | Mutagen | UV/TMP | |||||
| Description | Phenotype | WBPhenotype:0000519 | Paper_evidence | WBPaper00033444 | |||
| Curator_confirmed | WBPerson2021 | ||||||
| Remark | Mutant strains tested showed altered fitness compared to wild type when exposed to different bacterial environments such as E. coli, M. luteus, and Pseudomonas sp.and B. megaterium | Paper_evidence | WBPaper00033444 | ||||
| Curator_confirmed | WBPerson2021 | ||||||
| Variation_effect | Null | Paper_evidence | WBPaper00033444 | ||||
| Curator_confirmed | WBPerson2021 | ||||||
| Phenotype_not_observed | WBPhenotype:0000886 | Paper_evidence | WBPaper00026922 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0000961 | Paper_evidence | WBPaper00026922 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | PGL-1-GFP has a normal localization pattern. | Paper_evidence | WBPaper00026922 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0001403 | Paper_evidence | WBPaper00026922 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | CGH-1 has normal localization based on anti-CGH-1 staining | Paper_evidence | WBPaper00026922 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Disease_info | Models_disease | DOID:1289 | |||||
| Models_disease_in_annotation | WBDOannot00000982 | ||||||
| Reference | WBPaper00026922 | ||||||
| WBPaper00033444 | |||||||
| Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||
| Method | KO_consortium_allele |
