WormBase Tree Display for Variation: WBVar00091925
expand all nodes | collapse all nodes | view schema
WBVar00091925 | Name | Public_name | ok641 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | R13F6.4a.2:c.1174_3204del | ||||||||
CE47066:p.His727_Ser1403delextTer? | |||||||||
CE42908:p.His574_Ser1250delextTer? | |||||||||
CE46838:p.His392_Ser1068delextTer? | |||||||||
R13F6.4f.1:c.1957_3987del | |||||||||
R13F6.4d.1:c.1720_3750del | |||||||||
R13F6.4a.1:c.1174_3204del | |||||||||
R13F6.4e.1:c.2179_4209del | |||||||||
CE46882:p.His653_Ser1329delextTer? | |||||||||
HGVSg | CHROMOSOME_III:g.6839859_6841988del | ||||||||
Sequence_details | SMap | S_parent | Sequence | R13F6 | |||||
Flanking_sequences | gattgttcagtttttgctgatgcaattgta | agtcttgaaccacaagattctcgaaacaac | |||||||
Mapping_target | R13F6 | ||||||||
Type_of_mutation | Deletion | ||||||||
PCR_product | ok641_external | ||||||||
ok641_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00035839 | ||||||||
Laboratory | RB | ||||||||
Person | WBPerson46 | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006498 | |||||||
Transcript | R13F6.4f.1 (11) | ||||||||
R13F6.4e.1 (11) | |||||||||
R13F6.4a.1 (11) | |||||||||
R13F6.4a.2 (11) | |||||||||
R13F6.4d.1 (11) | |||||||||
Interactor | WBInteraction000500418 | ||||||||
WBInteraction000500419 | |||||||||
WBInteraction000504386 | |||||||||
Isolation | Mutagen | UV/TMP | |||||||
Description | Phenotype | WBPhenotype:0000038 | Paper_evidence | WBPaper00032026 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Some ten-1 homozygotes burst through the vulva due to germ cell leakage in the middle of the gonad | Paper_evidence | WBPaper00032026 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00032026 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000059 | Paper_evidence | WBPaper00032026 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Ten-1 null mutants also arrest as L1 larvae | Paper_evidence | WBPaper00032026 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00032026 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000023 | PATO:0000460 | Paper_evidence | WBPaper00032026 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000174 | Paper_evidence | WBPaper00032026 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | As the gonadal precursor cells divided, a discontinuity appeared in the ten-1(ok641) gonadal BM that could be seen by a lack of laminin as well as of collagen IV LET-2 | Paper_evidence | WBPaper00032026 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00032026 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005756 | PATO:0000460 | Paper_evidence | WBPaper00032026 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Basement membrane was examined using LAM-1::GFP and LET-2 antibody | Paper_evidence | WBPaper00032026 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Genotype | urEx131[LAM-1::GFP] | Paper_evidence | WBPaper00032026 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000490 | Paper_evidence | WBPaper00032026 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Ten-1 null mutants exhibit malformed pharynges and disorganized pharyngeal basement membranes | Paper_evidence | WBPaper00032026 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00032026 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003681 | PATO:0000460 | Paper_evidence | WBPaper00032026 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000023 | PATO:0000460 | Paper_evidence | WBPaper00032026 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | urEx131[LAM-1::GFP] | Paper_evidence | WBPaper00032026 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000667 | Paper_evidence | WBPaper00032026 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Z1 and Z4 cells were often displaced from the tips of the early L1 gonads in ten-1(ok641) worms. In almost 20% of the mutants, Z1 and/or Z4 cells interdigitated between germ cell precursors Z2 and Z3, or sometimes one of the SGPs was lost | Paper_evidence | WBPaper00032026 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00032026 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | qIs19 [lag-2::gfp] | Paper_evidence | WBPaper00032026 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00032026 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutation of the ten-1 gene leads to sterility | Paper_evidence | WBPaper00032026 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00032026 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00032026 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000913 | Paper_evidence | WBPaper00032026 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Basement Membrane was absent on the dorsal side of the broken gonad in ten-1 mutants and germ cells invaded the intestine | Paper_evidence | WBPaper00032026 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00032026 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005756 | PATO:0000460 | Paper_evidence | WBPaper00032026 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0005175 | PATO:0000460 | Paper_evidence | WBPaper00032026 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Basement membrane was examined via EM | Paper_evidence | WBPaper00032026 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000977 | Paper_evidence | WBPaper00032026 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Gonadal primordium of ten-1(ok641) larvae are ruptured. Germ cells are released into the body cavity and localize in the vicinity of the developing somatic gonad primordium. | Paper_evidence | WBPaper00032026 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00032026 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005785 | PATO:0000460 | Paper_evidence | WBPaper00032026 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_not_observed | WBPhenotype:0001215 | Paper_evidence | WBPaper00032026 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | There is no germline overproliferation in the early gonads of the ten-1(ok641) mutant | Paper_evidence | WBPaper00032026 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null | Paper_evidence | WBPaper00032026 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005175 | PATO:0000460 | Paper_evidence | WBPaper00032026 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000023 | PATO:0000460 | Paper_evidence | WBPaper00032026 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | pie-1p::GFP::PGL-1 | Paper_evidence | WBPaper00032026 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00032026 | ||||||||
WBPaper00025910 | |||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |