WormBase Tree Display for Variation: WBVar00091833
expand all nodes | collapse all nodes | view schema
WBVar00091833 | Name | Public_name | ok546 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | K10B4.6a.1:c.161+156_414del | ||||||||
HGVSg | CHROMOSOME_II:g.132477_133261del | ||||||||
Sequence_details | SMap | S_parent | Sequence | K10B4 | |||||
Flanking_sequences | tgagtgatcgtttttcgagtagtcacaacc | tgagaaattttcaagaagatttatcatgaa | |||||||
Mapping_target | K10B4 | ||||||||
Type_of_mutation | Deletion | ||||||||
PCR_product | OK546_external | ||||||||
OK546_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (21) | |||||||||
Laboratory | RB | ||||||||
Person | WBPerson46 | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000857 | |||||||
Transcript | K10B4.6a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | K10B4.6a.1:c.161+156_414del | ||||||||
cDNA_position | ?-435 | ||||||||
CDS_position | ?-414 | ||||||||
Protein_position | ?-138 | ||||||||
Intron_number | 2-4/10 | ||||||||
Exon_number | 3-5/11 | ||||||||
Interactor (45) | |||||||||
Isolation | Mutagen | UV/TMP | |||||||
Description | Phenotype | WBPhenotype:0000219 | Paper_evidence | WBPaper00031110 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 13% of animals were underinduced (worms with fewer than 22 vulval cells or fewer than three VPCs induced). | Paper_evidence | WBPaper00031110 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000239 | Paper_evidence | WBPaper00039829 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Heterozygous mutants displayed a reduction in P3.p and P4.p division frequencies compared to N2. | Paper_evidence | WBPaper00039829 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Haplo_insufficient | Paper_evidence | WBPaper00039829 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000384 | Paper_evidence | WBPaper00027140 | |||||||
Curator_confirmed | WBPerson3779 | ||||||||
EQ_annotations | GO_term | GO:0007411 | PATO:0000460 | Paper_evidence | WBPaper00027140 | ||||
Curator_confirmed | WBPerson3779 | ||||||||
WBPhenotype:0000469 | Paper_evidence | WBPaper00026706 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "... because each deletion removes a large portion of the gene, each is likely to eliminate gene function... Mutations in cwn-1, cwn-2, and egl-20 disrupted the migrations of QR descendant cells, as well as others, raising the possibility that they could function through CFZ-2 (Table 1; Desai et al., 1988; Forrester et al., 2004; Harris et al., 1996)... We focused on cwn-1, cwn-2, and egl-20 because they produced defects in QR descendant cell migration (Fig. 4, Table 1), a cfz-2 phenotype." | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | 73 | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Predicted_null_via_sequence | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004991 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0003832 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | "A QR cell descendant was scored as defective if its nucleus was posterior to the V2.a nucleus. Because they occupy positions near each other, the data for SDQR and AVM were combined. The position of AQR, a third QR descendant, was not included because it migrates to a location near other nuclei with similar morphology." | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000470 | Paper_evidence | WBPaper00027140 | |||||||
Curator_confirmed | WBPerson3779 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006830 | PATO:0000460 | Paper_evidence | WBPaper00027140 | ||||
Curator_confirmed | WBPerson3779 | ||||||||
GO_term | GO:0001764 | PATO:0000460 | Paper_evidence | WBPaper00027140 | |||||
Curator_confirmed | WBPerson3779 | ||||||||
WBPhenotype:0000471 | Paper_evidence | WBPaper00026706 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "We found that both cwn-1 and cwn-2 mutations not only affected migrations of subsets of neurons (Table 1), but also resulted in defects in axon development and guidance (Table 2)." | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Low | 8 | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Predicted_null_via_sequence | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005406 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | "An ALM was scored as anteriorly misplaced (Ant.) if its nucleus was anterior to the V2 nucleus and posteriorly misplaced (Post.) if posterior to the V3 nucleus." | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000594 | Paper_evidence | WBPaper00026706 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "We found that both cwn-1 and cwn-2 mutations not only affected migrations of subsets of neurons (Table 1), but also resulted in defects in axon development and guidance (Table 2)." | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | 18 | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Predicted_null_via_sequence | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006826 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | "A BDU was scored as defective if its nucleus was posterior to the V1 nucleus." | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001761 | Paper_evidence | WBPaper00026706 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "We found that both cwn-1 and cwn-2 mutations not only affected migrations of subsets of neurons (Table 1), but also resulted in defects in axon development and guidance (Table 2)." | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | 33 | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Predicted_null_via_sequence | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006830 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0007409 | PATO:0000460 | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | "Axon morphology was examined by indirect immunofluorescence using anti-serotonin antibody (HSN and CP) or two independent GFP-expressing reporter transgenes, ceh-23::gfp and kal-1::gfp (CAN)." | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002490 | Paper_evidence | WBPaper00026706 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "We found that both cwn-1 and cwn-2 mutations not only affected migrations of subsets of neurons (Table 1), but also resulted in defects in axon development and guidance (Table 2)." | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance (2) | |||||||||
Variation_effect | Predicted_null_via_sequence | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term (11) | ||||||||
GO_term | GO:0007409 | PATO:0000460 | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | "Axon morphology was examined by indirect immunofluorescence using anti-serotonin antibody (HSN and CP) or two independent GFP-expressing reporter transgenes, ceh-23::gfp and kal-1::gfp (CAN)." | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_not_observed | WBPhenotype:0000050 | Paper_evidence | WBPaper00025190 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000104 | Paper_evidence | WBPaper00044679 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | The cwn-1(ok546) mutation does not affect anteroposterior polarity in the AVG interneuron | Paper_evidence | WBPaper00044679 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003850 | PATO:0000460 | Paper_evidence | WBPaper00044679 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000218 | Paper_evidence | WBPaper00031110 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No significant number of overinduced animals (worms with greater than three VPCs induced) were detected. | Paper_evidence | WBPaper00031110 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000232 | Paper_evidence | WBPaper00026706 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "We found that both cwn-1 and cwn-2 mutations not only affected migrations of subsets of neurons (Table 1), but also resulted in defects in axon development and guidance (Table 2)." | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Predicted_null_via_sequence | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006827 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | "A CAN was scored as anteriorly misplaced (Ant.) if its nucleus was anterior to the V3 nucleus and posteriorly misplaced (Post.) if posterior to the V4 nucleus." | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000469 | Paper_evidence | WBPaper00026706 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "We found that both cwn-1 and cwn-2 mutations not only affected migrations of subsets of neurons (Table 1), but also resulted in defects in axon development and guidance (Table 2)." | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Predicted_null_via_sequence | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004993 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004086 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | "A QL cell descendant was scored as misplaced anteriorly if its nucleus was anterior to V4.p. Because they occupy positions near each other, the data for SDQL and PVM were combined. The position of PQR, a third QL descendant, was not included because it migrates to a location near other nuclei with similar morphology." | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000470 | Paper_evidence | WBPaper00026706 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "We found that both cwn-1 and cwn-2 mutations not only affected migrations of subsets of neurons (Table 1), but also resulted in defects in axon development and guidance (Table 2)." | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Predicted_null_via_sequence | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006830 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | "An HSN was scored as defective if its nucleus was posterior to the V4 nucleus." | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000471 | Paper_evidence | WBPaper00038522 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | ALM does not exhibit significant migration defects. | Paper_evidence | WBPaper00038522 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005406 | PATO:0000460 | Paper_evidence | WBPaper00038522 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000633 | Paper_evidence | WBPaper00026706 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 2 | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Predicted_null_via_sequence | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004903 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004901 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004899 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004897 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004895 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004893 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004891 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004889 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004888 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004887 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0007409 | PATO:0000460 | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | "Axon morphology was examined by indirect immunofluorescence using anti-serotonin antibody (HSN and CP) or two independent GFP-expressing reporter transgenes, ceh-23::gfp and kal-1::gfp (CAN)." | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000883 | Paper_evidence | WBPaper00035405 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Nerve ring development is normal | Paper_evidence | WBPaper00035405 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null (2) | ||||||||
WBPhenotype:0001408 | Paper_evidence | WBPaper00039829 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The anterior LIN-39 level, as assayed through LIN-39::GFP protein fusion expression, was not altered at the early L2 stage. | Paper_evidence | WBPaper00039829 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00038522 | ||||||||
WBPaper00039829 | |||||||||
WBPaper00010775 | |||||||||
WBPaper00031110 | |||||||||
WBPaper00035405 | |||||||||
WBPaper00026706 | |||||||||
WBPaper00027140 | |||||||||
WBPaper00025190 | |||||||||
WBPaper00026256 | |||||||||
WBPaper00044679 | |||||||||
Remark | Last updated on 29 Nov 2002 | ||||||||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||||||
Method | KO_consortium_allele |