WormBase Tree Display for Variation: WBVar00091741
expand all nodes | collapse all nodes | view schema
WBVar00091741 | Evidence | Paper_evidence | WBPaper00033444 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | ok450 | |||||
HGVSg | CHROMOSOME_X:g.6818899_6820954delinsGGGTTTCAAGGTCC | ||||||
Sequence_details | SMap | S_parent | Sequence | F41B4 | |||
Flanking_sequences | ctgctcaattttcagatcttatcttcaagg | tttttttttttcattttttttgtatgatac | |||||
Mapping_target | F41B4 | ||||||
Type_of_mutation | Insertion | GGGTTTCAAGGTCC | |||||
Deletion | |||||||
PCR_product | ok450_external | ||||||
ok450_internal | |||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00035626 | ||||||
Laboratory | RB | ||||||
Person | WBPerson46 | ||||||
KO_consortium_allele | |||||||
Status | Live | ||||||
Affects | Gene | WBGene00001572 | |||||
WBGene00000991 | |||||||
Transcript | M03A8.4.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | ||||
VEP_impact | HIGH | ||||||
Intron_number | 7-10/11 | ||||||
Exon_number | 8-12/12 | ||||||
M03A8.1.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | ||||||
cDNA_position | 366-? | ||||||
CDS_position | 359-? | ||||||
Protein_position | 120-? | ||||||
Intron_number | 4-6/7 | ||||||
Exon_number | 4-8/8 | ||||||
Isolation | Mutagen | UV/TMP | |||||
Genetics | Mapping_data | In_multi_point | 4258 | ||||
4343 | |||||||
Description | Phenotype | WBPhenotype:0000519 | Paper_evidence | WBPaper00033444 | |||
Curator_confirmed | WBPerson2021 | ||||||
Remark | Mutant strains tested showed altered fitness compared to wild type when exposed to different bacterial environments such as E. coli, M. luteus, and Pseudomonas sp.and B. megaterium | Paper_evidence | WBPaper00033444 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Variation_effect | Null | Paper_evidence | WBPaper00033444 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Reference | WBPaper00033444 | ||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||
Method | KO_consortium_allele |