WormBase Tree Display for Variation: WBVar00091739
expand all nodes | collapse all nodes | view schema
| WBVar00091739 | Evidence | Paper_evidence | WBPaper00031901 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | ok448 | |||||||
| Other_name | C09B8.7c.1:c.661_1369del | ||||||||
| CE27670:p.Lys270AsnfsTer10 | |||||||||
| C09B8.7a.1:c.808_1516del | |||||||||
| CE33559:p.Lys221AsnfsTer10 | |||||||||
| CE06792:p.Lys267AsnfsTer10 | |||||||||
| C09B8.7b.1:c.799_1507del | |||||||||
| HGVSg | CHROMOSOME_X:g.6045254_6046678del | ||||||||
| Sequence_details | SMap | S_parent | Sequence | C09B8 | |||||
| Flanking_sequences | tcatggaatctcttccagggaagtcgggtt | AGCTTTTTGACCTCTGGCCTGTACACCAAA | |||||||
| Mapping_target | C09B8 | ||||||||
| Type_of_mutation | Deletion | ||||||||
| PCR_product | OK448_external | ||||||||
| OK448_internal | |||||||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00000137 | ||||||||
| WBStrain00031427 | |||||||||
| Laboratory | RB | ||||||||
| Person | WBPerson46 | ||||||||
| KO_consortium_allele | |||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00003911 | |||||||
| Transcript | C09B8.7c.1 (11) | ||||||||
| C09B8.7b.1 (11) | |||||||||
| C09B8.7a.1 (11) | |||||||||
| Interactor | WBInteraction000518804 | ||||||||
| WBInteraction000518805 | |||||||||
| WBInteraction000521275 | |||||||||
| Isolation | Mutagen | UV/TMP | |||||||
| Genetics | Mapping_data | In_multi_point | 4562 | ||||||
| Description | Phenotype | WBPhenotype:0000061 | Paper_evidence | WBPaper00042159 | |||||
| Curator_confirmed | WBPerson708 | ||||||||
| WBPhenotype:0000384 | Paper_evidence | WBPaper00031901 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | 254% of HSN axons exhibited mild guidance defects that were partially penetrant. | Paper_evidence | WBPaper00031901 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Penetrance | Incomplete | Paper_evidence | WBPaper00031901 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031901 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0006830 | PATO:0000460 | Paper_evidence | WBPaper00031901 | ||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000531 | Paper_evidence | WBPaper00038193 | |||||||
| Curator_confirmed | WBPerson351 | ||||||||
| Remark | Young L1 larvae are slightly short and have a head bump, which disappears by the middle of L1. The phenotype is not easy to spot | Paper_evidence | WBPaper00038193 | ||||||
| Curator_confirmed | WBPerson351 | ||||||||
| Temperature_sensitive | Cold_sensitive | Paper_evidence | WBPaper00038193 | ||||||
| Curator_confirmed | WBPerson351 | ||||||||
| Phenotype_not_observed | WBPhenotype:0000593 | Paper_evidence | WBPaper00035583 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | pak-1(ok448) mutant animals did not exhibit a copper sensitivity (Figure 1C) | Paper_evidence | WBPaper00035583 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Affected_by | Molecule | WBMol:00002862 | Paper_evidence | WBPaper00035583 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Phenotype_assay | Treatment | Each animal was cultured from embryogenesis on NGM plates containing 100 micromolar copper ion. The percentages of worms reaching adulthood 4 days after egg laying were scored. | Paper_evidence | WBPaper00035583 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Reference | WBPaper00038193 | ||||||||
| WBPaper00031901 | |||||||||
| WBPaper00035583 | |||||||||
| WBPaper00042159 | |||||||||
| Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
| Method | KO_consortium_allele |
