WormBase Tree Display for Variation: WBVar00091728
expand all nodes | collapse all nodes | view schema
WBVar00091728 | Name | Public_name | ok434 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | R11A8.4a.1:c.810_1501-14del | ||||||||
R11A8.4b.1:c.720_1411-14del | |||||||||
HGVSg | CHROMOSOME_IV:g.10363970_10364735del | ||||||||
Sequence_details | SMap | S_parent | Sequence | R11A8 | |||||
Flanking_sequences | ggtttgatgagcagaaatctgaagaaaaaa | atttttgtccacaacgtgtacatgtacatt | |||||||
Mapping_target | R11A8 | ||||||||
Type_of_mutation | Insertion | tt | |||||||
Deletion | |||||||||
PCR_product | OK434_external | ||||||||
OK434_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00022167 | ||||||||
WBStrain00026544 | |||||||||
WBStrain00035578 | |||||||||
WBStrain00047283 | |||||||||
Laboratory | RB | ||||||||
Person | WBPerson46 | ||||||||
KO_consortium_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00004800 | |||||||
Transcript | R11A8.4a.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | R11A8.4a.1:c.810_1501-14del | ||||||||
cDNA_position | 850-? | ||||||||
CDS_position | 809-? | ||||||||
Protein_position | 270-? | ||||||||
Intron_number | 6/8 | ||||||||
Exon_number | 6/9 | ||||||||
R11A8.4b.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | R11A8.4b.1:c.720_1411-14del | ||||||||
cDNA_position | 719-? | ||||||||
CDS_position | 719-? | ||||||||
Protein_position | 240-? | ||||||||
Intron_number | 4/5 | ||||||||
Exon_number | 4/6 | ||||||||
Interactor (22) | |||||||||
Genetics | Mapping_data | In_multi_point | 4660 | ||||||
Description | Phenotype | WBPhenotype:0000039 | Paper_evidence | WBPaper00047022 | |||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | Otophylloside B (Ot B), a C-21 steroidal glycoside, extended adult lifespan in C. elegans (N2 strain). Authors showed that Ot B could not lengthen the lifespan of the long-lived sir-2.1(ok434) mutant. Thus, they postulate that SIR-2.1 is necessary for Ot B-mediated lifespan extension. | Paper_evidence | WBPaper00047022 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
Affected_by | Molecule | WBMol:00007846 | Paper_evidence | WBPaper00047022 | |||||
Curator_confirmed | WBPerson557 | ||||||||
Phenotype_assay | Treatment | Animals grown on 50uM Otophylloside (Ot B). Ot B is a C-21 steroidal glycoside isolated from Qingyangshen (Cynanchum otophyllum schneid), a herbaceous plant used in traditional Chinese medicine. | Paper_evidence | WBPaper00047022 | |||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0000119 | Paper_evidence | WBPaper00036476 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Nuclear levels of SBP-1::GFP are robust in fasted SBP-1::GFP; sir-2.1 (lof) intestines, whereas they are significantly decreased in control animals under the same conditions. | Paper_evidence | WBPaper00036476 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00036476 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005772 | PATO:0000460 | Paper_evidence | WBPaper00036476 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000631 | Paper_evidence | WBPaper00038093 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No life span extending effect was observed for mutants fed polyphenol-enriched cocoa powder. | Paper_evidence | WBPaper00038093 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00002995 | Paper_evidence | WBPaper00038093 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001171 | Paper_evidence | WBPaper00029007 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | weak | Paper_evidence | WBPaper00029007 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0001184 | Paper_evidence | WBPaper00036476 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Sudan Black staining reveals animals exhibit high levels of lipid under both normal and fasted conditions. | Paper_evidence | WBPaper00036476 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00036476 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005772 | PATO:0000460 | Paper_evidence | WBPaper00036476 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001348 | Paper_evidence | WBPaper00046016 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | Decreased X chromosome compaction leading to enlarged X chromosomes. | Paper_evidence | WBPaper00046016 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0001361 | Paper_evidence | WBPaper00046016 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | Decreased X chromosome compaction leading to enlarged X chromosomes. | Paper_evidence | WBPaper00046016 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0001620 | Paper_evidence | WBPaper00038093 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | This mutant did not possess resistance to oxidative stress when fed with polyphenol enriched cocoa powder. | Paper_evidence | WBPaper00038093 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00001695 | Paper_evidence | WBPaper00038093 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBMol:00002995 | Paper_evidence | WBPaper00038093 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001871 | Paper_evidence | WBPaper00026929 | |||||||
WBPaper00031326 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2857 | |||||||||
Remark | While wild-type worms demonstrated a significant increase in life span in the presence of 1 mM resveratrol, neither sir-2.1 mutant strain showed a significant change in life span at any of the concentrations of resveratrol tested. | Paper_evidence | WBPaper00026929 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
animals are not long-lived when grown in hydrogen sulfide | Paper_evidence | WBPaper00031326 | |||||||
Curator_confirmed | WBPerson2857 | ||||||||
Affected_by | Molecule | WBMol:00004910 | Paper_evidence | WBPaper00026929 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002539 | Paper_evidence | WBPaper00047109 | |||||||
Curator_confirmed | WBPerson15627 | ||||||||
Remark | Fig 1D, the expression of the genes lys-1, lys-7, lys-8, F01D5.5, F56D6.2, C17H12.8, C29F3.7, K08D8.5 is increased in the mutant sir-2.1(ok434) | Paper_evidence | WBPaper00047109 | ||||||
Curator_confirmed | WBPerson15627 | ||||||||
Phenotype_not_observed | WBPhenotype:0000114 | Paper_evidence | WBPaper00036476 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Transcript levels of sbp-1 are only very modestly altered by the loss of sir-2.1. | Paper_evidence | WBPaper00036476 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00036476 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000631 | Paper_evidence | WBPaper00046162 | |||||||
Curator_confirmed | WBPerson2857 | ||||||||
Remark | animals are protected from effects of hypoxia on proteostasis by exposure to hydrogen sulfide similar to wild-type | Paper_evidence | WBPaper00046162 | ||||||
Curator_confirmed | WBPerson2857 | ||||||||
Affected_by | Molecule | WBMol:00004296 | Paper_evidence | WBPaper00046162 | |||||
Curator_confirmed | WBPerson2857 | ||||||||
WBPhenotype:0000966 | Paper_evidence | WBPaper00028759 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | germline is immortal at 20 and 25 degrees Celsius | Paper_evidence | WBPaper00028759 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
Phenotype_assay | Treatment | Strains propagated for many generations and checked for sterility | Paper_evidence | WBPaper00028759 | |||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0001012 | Paper_evidence | WBPaper00032003 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals were not more resistant than wild-type animals to S. enterica-mediated killing. | Paper_evidence | WBPaper00032003 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00032003 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | A total of 20 ml of culture was plated onto a 3.5 cm plate containing modified NGM (3.5% peptone instead of 2.5%). Synchronized one-day-old adult hermaphroditic nematodes were transferred to lawns of the various bacteria and transferred daily to a fresh lawn until progeny were no longer produced. | Paper_evidence | WBPaper00032003 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 25 | Paper_evidence | WBPaper00032003 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001991 | Paper_evidence | WBPaper00046162 | |||||||
Curator_confirmed | WBPerson2857 | ||||||||
Remark | animals develop the same number of polyglutamine aggregates as wild-type when exposed to environment with only 1000 ppm oxygen | Paper_evidence | WBPaper00046162 | ||||||
Curator_confirmed | WBPerson2857 | ||||||||
Disease_info | Models_disease | DOID:1574 | |||||||
Models_disease_in_annotation | WBDOannot00000675 | ||||||||
Reference (14) | |||||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |