WormBase Tree Display for Variation: WBVar00091724
expand all nodes | collapse all nodes | view schema
WBVar00091724 | Evidence | Paper_evidence | WBPaper00028382 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | ok430 | ||||||
Other_name | CE25042:p.Tyr454_Ter796delinsTer | |||||||
K04G7.3b.1:c.828_1853delinsAGGGGGATCTAAAGTCTCTAGGGAGTCTAGGGAGGTCTATTTTGCCAAACATTTCCAGTCACTGTTTGAATTCTTTCTAAATTATTCCTCATTCAATAAAACAAAATTTATTGCATTTTATTTTTTCGAGATCTAAATTGT | ||||||||
K04G7.3a.1:c.1362_2387delinsAGGGGGATCTAAAGTCTCTAGGGAGTCTAGGGAGGTCTATTTTGCCAAACATTTCCAGTCACTGTTTGAATTCTTTCTAAATTATTCCTCATTCAATAAAACAAAATTTATTGCATTTTATTTTTTCGAGATCTAAATTGT | ||||||||
CE39588:p.Tyr276_Ter618delinsTer | ||||||||
HGVSg | CHROMOSOME_III:g.7148323_7149416delinsACAATTTAGATCTCGAAAAAATAAAATGCAATAAATTTTGTTTTATTGAATGAGGAATAATTTAGAAAGAATTCAAACAGTGACTGGAAATGTTTGGCAAAATAGACCTCCCTAGACTCCCTAGAGACTTTAGATCCCCCT | |||||||
Sequence_details | SMap | S_parent | Sequence | K04G7 | ||||
Flanking_sequences | ATATATGCGAGCTTCTCTGTAAATGCATTT | TATAGTCGAGTGGCATCTTCGATCTTTCCT | ||||||
Mapping_target | K04G7 | |||||||
Type_of_mutation | Insertion | acaatttagatctcgaaaaaataaaatgcaataaattttgttttattgaatgaggaataatttagaaagaattcaaacagtgactggaaatgtttggcaaaatagacctccctagactccctagagactttagatccccct | ||||||
Deletion | ||||||||
PCR_product | OK430_external | |||||||
OK430_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00031394 | |||||||
WBStrain00055877 | ||||||||
Laboratory | RB | |||||||
JH | ||||||||
Person | WBPerson46 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00003858 | ||||||
Transcript | K04G7.3a.1 (11) | |||||||
K04G7.3b.1 (11) | ||||||||
Interactor | WBInteraction000504353 | |||||||
WBInteraction000518026 | ||||||||
WBInteraction000518027 | ||||||||
WBInteraction000518031 | ||||||||
WBInteraction000518543 | ||||||||
Isolation | Mutagen | UV/TMP | ||||||
Genetics | Mapping_data | In_multi_point | 4557 | |||||
Description | Phenotype (14) | |||||||
Phenotype_not_observed | WBPhenotype:0000070 | Paper_evidence | WBPaper00064694 | |||||
Curator_confirmed | WBPerson60111 | |||||||
Remark | Fig S3, male tail rays normal | Paper_evidence | WBPaper00064694 | |||||
Curator_confirmed | WBPerson60111 | |||||||
Phenotype_assay | Genotype | him-5(e1490) V | Paper_evidence | WBPaper00064694 | ||||
Curator_confirmed | WBPerson60111 | |||||||
WBPhenotype:0000673 | Paper_evidence | WBPaper00036090 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "In addition to lifespan regulation and dauer formation, the DAF-2 insulin-like receptor also regulates fertility: daf-2(e1370) mutations reduce fertility in a DAF-16 and temperature-dependent manner (31) (Fig 4D). However, although mutations in oga-1 and ogt-1 modulate dauer formation and lifespan in a daf-2(e1370) mutant, there was no statistical difference in brood size among the three strains (Fig 4D). These findings suggest that O-GlcNAc cycling is important for control of dauer formation and lifespan regulation, but not hermaphrodite self-fertilization and reproduction." | Paper_evidence | WBPaper00036090 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Disease_info | Models_disease | DOID:9351 | ||||||
DOID:9352 | ||||||||
Models_disease_in_annotation | WBDOannot00000733 | |||||||
WBDOannot00000734 | ||||||||
WBDOannot00000915 | ||||||||
WBDOannot00000916 | ||||||||
Reference | WBPaper00038233 | |||||||
WBPaper00035502 | ||||||||
WBPaper00036090 | ||||||||
WBPaper00045080 | ||||||||
WBPaper00065742 | ||||||||
WBPaper00064694 | ||||||||
Remark (2) | ||||||||
Method | KO_consortium_allele |