WormBase Tree Display for Variation: WBVar00091704

WBVar00091704 Name: Public_name: ok410
    Other_name: DY3.4a.3:c.526_1306delinsTTGCAAATATGGC
      DY3.4b.1:c.364_1144delinsTTGCAAATATGGC
      DY3.4a.1:c.526_1306delinsTTGCAAATATGGC
      DY3.4b.2:c.364_1144delinsTTGCAAATATGGC
      CE27901:p.Met122_Ter382delinsLeuGlnIleTrpArg
      DY3.4a.2:c.526_1306delinsTTGCAAATATGGC
      CE15748:p.Met176_Ter436delinsLeuGlnIleTrpArg
    HGVSg: CHROMOSOME_I:g.8769235_8770677delinsTTGCAAATATGGC
  Sequence_details: SMap: S_parent: Sequence: DY3
    Flanking_sequences: ttcactcgcgcatttcgtgcatctaaagtt ggagaattacaaaaggagttccacagggac
    Mapping_target: DY3
    Type_of_mutation: Insertion: ttgcaaatatggc
      Deletion
    PCR_product: OK410_external
      OK410_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00031417
      WBStrain00040707
    Laboratory: RB
    Person: WBPerson46
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00006618
    Transcript: DY3.4a.3 (11)
      DY3.4a.1 (11)
      DY3.4b.1 (11)
      DY3.4b.2 (11)
      DY3.4a.2 (11)
  Genetics: Mapping_data: In_multi_point: 4741
  Description: Phenotype: WBPhenotype:0000879 Paper_evidence: WBPaper00031859
        Curator_confirmed: WBPerson712
        Remark: Telomeres appeared slightly longer or shorter than in wild-type, as assayed by Southern blot, and each telomeric band appeared more discrete. Paper_evidence: WBPaper00031859
            Curator_confirmed: WBPerson712
        Recessive: Paper_evidence: WBPaper00031859
          Curator_confirmed: WBPerson712
      WBPhenotype:0000966 Paper_evidence: WBPaper00028759
          WBPaper00031859
        Curator_confirmed: WBPerson557
          WBPerson712
        Remark: Fecundity dropped (brood sizes decreased and sterile animals arose) as animals were serially passaged. The Mrt phenotype occurred regardless of excess food (sterility was reached after 24 generations) during the serial transfers or starvation (sterility was reached after 14 generations). Paper_evidence: WBPaper00031859
            Curator_confirmed: WBPerson712
        Phenotype_assay: Treatment: Strains propagated for many generations and checked for sterility Paper_evidence: WBPaper00028759
              Curator_confirmed: WBPerson557
            Animals were grown for 1 week on a small agar plate with a lawn of E. coli OP50 as food, experiencing starvation in between passages. Paper_evidence: WBPaper00031859
              Curator_confirmed: WBPerson712
      WBPhenotype:0001904 Paper_evidence: WBPaper00050092
        Curator_confirmed: WBPerson10038
        Remark: Quote from paper: "Assessment of dose response lethality curves following acute Mn treatment showed a rightward shift in the curve for trt-1 mutants compared to wt worms. Thus trt-1 mutants (with LD50=30.72) exhibited less sensitivity to Mn-induced lethality compared to wt worms (with LD50=12.64). Two-way ANOVA showed significant effect on interaction between strain and Mn dose P < 0.05; genotype, P < 0.0001; dose, P < 0.0001 (Fig.3)" Paper_evidence: WBPaper00050092
            Curator_confirmed: WBPerson10038
        Variation_effect: Predicted_null_via_sequence: Paper_evidence: WBPaper00050092
            Curator_confirmed: WBPerson10038
      WBPhenotype:0002431 Paper_evidence: WBPaper00041021
        Curator_confirmed: WBPerson7
  Disease_info: Models_disease: DOID:162
    Models_disease_in_annotation: WBDOannot00001172
  Reference: WBPaper00041021
    WBPaper00028759
    WBPaper00031859
    WBPaper00050092
  Remark: Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele