WormBase Tree Display for Variation: WBVar00091703
expand all nodes | collapse all nodes | view schema
| WBVar00091703 | Name | Public_name | ok409 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Other_name | B0244.2.1:c.514+14_1467+167del | ||||||||
| HGVSg | CHROMOSOME_III:g.5762042_5763754del | ||||||||
| Sequence_details | SMap | S_parent | Sequence | B0244 | |||||
| Flanking_sequences | ggaagaagatattgaaggtatgattgcaaa | attctgaaaaaaatatgttaattacatggg | |||||||
| Mapping_target | B0244 | ||||||||
| Type_of_mutation | Deletion | ||||||||
| PCR_product | ok409_external | ||||||||
| ok409_internal | |||||||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00035598 | ||||||||
| Laboratory | RB | ||||||||
| Person | WBPerson46 | ||||||||
| KO_consortium_allele | |||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00022899 | |||||||
| WBGene00002048 | |||||||||
| WBGene00022897 | |||||||||
| WBGene00196359 | |||||||||
| Transcript | B0244.13 | VEP_consequence | transcript_ablation | ||||||
| VEP_impact | HIGH | ||||||||
| Exon_number | 1/1 | ||||||||
| B0244.2.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | B0244.2.1:c.514+14_1467+167del | ||||||||
| Intron_number | 4-8/13 | ||||||||
| Exon_number | 5-8/14 | ||||||||
| B0244.t1 | VEP_consequence | transcript_ablation | |||||||
| VEP_impact | HIGH | ||||||||
| Exon_number | 1/1 | ||||||||
| B0244.t3 | VEP_consequence | transcript_ablation | |||||||
| VEP_impact | HIGH | ||||||||
| Exon_number | 1/1 | ||||||||
| Interactor | WBInteraction000503956 | ||||||||
| WBInteraction000503957 | |||||||||
| Isolation | Mutagen | UV/TMP | |||||||
| Description | Phenotype | WBPhenotype:0001524 | Paper_evidence | WBPaper00036308 | |||||
| WBPaper00051118 | |||||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPerson38423 | |||||||||
| Remark | 5% of ida-1(ok409) animals were resistant to EGF-induced sleep (Table 1) | Paper_evidence | WBPaper00036308 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Lethargus duration increased by 56%; total sleep increased by 54%; Bout duration decreased by 11% (Table 2A) | Paper_evidence | WBPaper00051118 | |||||||
| Curator_confirmed | WBPerson38423 | ||||||||
| Penetrance | Low | 5 | Paper_evidence | WBPaper00036308 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Phenotype_assay | Treatment | Animals carrying the hs:LIN-3 transgene were well fed and grown at 20C. Young adult animals were scored 2 hours after heat shock for EGF-induced sleep behavior (see Materials and methods). | Paper_evidence | WBPaper00036308 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Genotype | hs:LIN-3 | Paper_evidence | WBPaper00036308 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Phenotype_not_observed | WBPhenotype:0001765 | Paper_evidence | WBPaper00031936 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | Mutants defective in neuromodulation respond normally to CO2 | Paper_evidence | WBPaper00031936 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00031936 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_assay | Treatment | 10% CO2 | Paper_evidence | WBPaper00031936 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Reference | WBPaper00031936 | ||||||||
| WBPaper00036308 | |||||||||
| WBPaper00019564 | |||||||||
| WBPaper00051118 | |||||||||
| Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
| Method | KO_consortium_allele |
