WormBase Tree Display for Variation: WBVar00091678
expand all nodes | collapse all nodes | view schema
WBVar00091678 | Evidence | Paper_evidence | WBPaper00038275 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | ok383 | |||||
Other_name | ZK470.5a.1:c.249+644_250-244del | ||||||
ZK470.5b.1:c.249+644_250-244del | |||||||
HGVSg | CHROMOSOME_X:g.4151001_4151899del | ||||||
Sequence_details | SMap | S_parent | Sequence | ZK470 | |||
Flanking_sequences | gtagagttctaacacaaaagaaatagtgta | ataatcctgggaaaacaggggaagaagagt | |||||
Mapping_target | ZK470 | ||||||
Type_of_mutation | Deletion | ||||||
PCR_product | OK383_external | ||||||
OK383_internal | |||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00035589 | ||||||
Laboratory | RB | ||||||
Person | WBPerson46 | ||||||
KO_consortium_allele | |||||||
Status | Live | ||||||
Affects | Gene | WBGene00006410 | |||||
Transcript | ZK470.5b.1 | VEP_consequence | intron_variant | ||||
VEP_impact | MODIFIER | ||||||
HGVSc | ZK470.5b.1:c.249+644_250-244del | ||||||
Intron_number | 3/8 | ||||||
ZK470.5a.1 | VEP_consequence | intron_variant | |||||
VEP_impact | MODIFIER | ||||||
HGVSc | ZK470.5a.1:c.249+644_250-244del | ||||||
Intron_number | 3/8 | ||||||
Isolation | Mutagen | UV/TMP | |||||
Description | Phenotype_not_observed | WBPhenotype:0000120 | Paper_evidence | WBPaper00038275 | |||
Curator_confirmed | WBPerson712 | ||||||
Remark | Immunoblots show that the NCK-1 proteins are still made. | Paper_evidence | WBPaper00038275 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00038275 | ||||||
Remark | Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||
Method | KO_consortium_allele |