WormBase Tree Display for Variation: WBVar00091519
expand all nodes | collapse all nodes | view schema
WBVar00091519 | Name | Public_name | ok214 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | F28F9.1.1:c.993+556_994-432del | |||||||
HGVSg | CHROMOSOME_IV:g.3858458_3859171del | |||||||
Sequence_details | SMap | S_parent | Sequence | F28F9 | ||||
Flanking_sequences | acagtttctcggtggagcatcatgttttag | aagatggcctgaaagtgcatcgggggctca | ||||||
Mapping_target | F28F9 | |||||||
Type_of_mutation | Deletion | |||||||
PCR_product (2) | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00031367 | |||||||
WBStrain00035789 | ||||||||
Laboratory | RB | |||||||
Person | WBPerson46 | |||||||
KO_consortium_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00006970 | ||||||
Transcript | F28F9.1.1 | VEP_consequence | intron_variant | |||||
VEP_impact | MODIFIER | |||||||
HGVSc | F28F9.1.1:c.993+556_994-432del | |||||||
Intron_number | 5/8 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Description | Phenotype | WBPhenotype:0000038 | Paper_evidence | WBPaper00040911 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | bursting through the vulva (alg-1 27%, n = 40) | Paper_evidence | WBPaper00040911 | |||||
Curator_confirmed | WBPerson712 | |||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00040911 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000280 | Paper_evidence | WBPaper00040911 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | gapped alae (alg-1 24%, n = 60) | Paper_evidence | WBPaper00040911 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000867 | Paper_evidence | WBPaper00040911 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Mutants do not have detectable embryonic lethality under standard growth conditions. | Paper_evidence | WBPaper00040911 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00040911 | |||||||
Remark | Last updated on 29 Nov 2002 | |||||||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | ||||||
Method | KO_consortium_allele |