WormBase Tree Display for Variation: WBVar00091430
expand all nodes | collapse all nodes | view schema
WBVar00091430 | Evidence | Paper_evidence | WBPaper00031872 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | nu468 | |||||||
Other_name (12) | |||||||||
HGVSg | CHROMOSOME_I:g.5548479_5548480delinsAA | ||||||||
Sequence_details | SMap | S_parent | Sequence | M01A10 | |||||
Flanking_sequences | tagtatacgacaagggaatagttgttcaat | aatttaggaacaagagaagttgatcgatat | |||||||
Mapping_target | M01A10 | ||||||||
Type_of_mutation | Substitution | gg | rr | Paper_evidence | WBPaper00031872 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | KP | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006594 | |||||||
Transcript | M01A10.2g.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | M01A10.2g.1:c.635_636delinsAA | ||||||||
HGVSp | CE50290:p.Trp212Ter | ||||||||
cDNA_position | 742-743 | ||||||||
CDS_position | 635-636 | ||||||||
Protein_position | 212 | ||||||||
Exon_number | 7/26 | ||||||||
Codon_change | tGG/tAA | ||||||||
Amino_acid_change | W/* | ||||||||
M01A10.2f.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | M01A10.2f.1:c.635_636delinsAA | ||||||||
HGVSp | CE41686:p.Trp212Ter | ||||||||
cDNA_position | 744-745 | ||||||||
CDS_position | 635-636 | ||||||||
Protein_position | 212 | ||||||||
Exon_number | 7/26 | ||||||||
Codon_change | tGG/tAA | ||||||||
Amino_acid_change | W/* | ||||||||
M01A10.2i.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | M01A10.2i.1:c.635_636delinsAA | ||||||||
HGVSp | CE50363:p.Trp212Ter | ||||||||
cDNA_position | 635-636 | ||||||||
CDS_position | 635-636 | ||||||||
Protein_position | 212 | ||||||||
Exon_number | 6/24 | ||||||||
Codon_change | tGG/tAA | ||||||||
Amino_acid_change | W/* | ||||||||
M01A10.2h.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | M01A10.2h.1:c.635_636delinsAA | ||||||||
HGVSp | CE50232:p.Trp212Ter | ||||||||
cDNA_position | 742-743 | ||||||||
CDS_position | 635-636 | ||||||||
Protein_position | 212 | ||||||||
Exon_number | 7/25 | ||||||||
Codon_change | tGG/tAA | ||||||||
Amino_acid_change | W/* | ||||||||
M01A10.2e.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | M01A10.2e.1:c.635_636delinsAA | ||||||||
HGVSp | CE41685:p.Trp212Ter | ||||||||
cDNA_position | 741-742 | ||||||||
CDS_position | 635-636 | ||||||||
Protein_position | 212 | ||||||||
Exon_number | 7/26 | ||||||||
Codon_change | tGG/tAA | ||||||||
Amino_acid_change | W/* | ||||||||
M01A10.2a.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | M01A10.2a.1:c.635_636delinsAA | ||||||||
HGVSp | CE40307:p.Trp212Ter | ||||||||
cDNA_position | 742-743 | ||||||||
CDS_position | 635-636 | ||||||||
Protein_position | 212 | ||||||||
Exon_number | 7/25 | ||||||||
Codon_change | tGG/tAA | ||||||||
Amino_acid_change | W/* | ||||||||
Isolation | Mutagen | EMS | Paper_evidence | WBPaper00026714 | |||||
Genetics | Interpolated_map_position | I | 0.108099 | ||||||
Description | Phenotype | WBPhenotype:0000016 | Paper_evidence | WBPaper00031872 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | % animals paralyzed after 60 min on 1mM aldicarb was significantly higher than % N2 animals paralyzed. | Paper_evidence | WBPaper00031872 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003650 | Paper_evidence | WBPaper00031872 | |||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007833 | PATO:0001549 | Paper_evidence | WBPaper00031872 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000420 | Paper_evidence | WBPaper00031872 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | % animals paralyzed after 60 min on 200mM levamisole was significantly higher than % N2 animals paralyzed under same conditions. | Paper_evidence | WBPaper00031872 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00004019 | Paper_evidence | WBPaper00031872 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00031872 | ||||||||
Remark | Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00006594 Amber_UAG_or_Opal_UGA W(212) to stop | Paper_evidence | WBPaper00026714 | ||||||
Method | Substitution_allele |