WormBase Tree Display for Variation: WBVar00091098
expand all nodes | collapse all nodes | view schema
WBVar00091098 | Evidence | Paper_evidence | WBPaper00029073 | ||
---|---|---|---|---|---|
Name | Public_name | WBVar00091098 | |||
Other_name | niDf77(IV) | ||||
Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_IV | |
Flanking_sequences | TGTAGCCTGTAGTCTTCTTGTAGTCCCAATTTGCAGGTGGCCATTAGTTG | CTCCCATTCCTACTATTGTTCATCGTCATCGAATGTGAGTTTTCTATCGC | |||
Mapping_target | CHROMOSOME_IV | ||||
Type_of_mutation | Deletion | ||||
SeqStatus | Sequenced | ||||
Variation_type | Natural_variant | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00004602 | ||||
Laboratory | VC | ||||
Person | WBPerson427 | ||||
Detection_method | Oligo Array CGH | ||||
Status | Live | Curator_confirmed | WBPerson4025 | ||
Affects | Gene (22) | ||||
Transcript (22) | |||||
Pseudogene (5) | |||||
Reference | WBPaper00029073 | ||||
Remark | Flanking sequences represent the nearest array oligo sequences present in the deletion chromsome on the basis of fluorescence ratio. These should not be considered hard breakpoints in the absence of actual sequence data. Original data available on-line at http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE6294. | ||||
This was suppressed because it overlapped with a corrected genome sequence error feature | Feature_evidence | WBsf899407 | |||
This was un-suppressed after examination showed it is not changed by the corrected genome sequence error | Curator_confirmed | WBPerson4025 | |||
Method | CGH_allele |