WormBase Tree Display for Variation: WBVar00091028
expand all nodes | collapse all nodes | view schema
WBVar00091028 | Evidence | Paper_evidence | WBPaper00029073 | ||
---|---|---|---|---|---|
Name | Public_name | WBVar00091028 | |||
Other_name | niDf7(X) | ||||
F39C12.3b.1:c.36-502_641delinsAG | |||||
F39C12.3a.3:c.-37-502_569delinsAG | |||||
F39C12.3a.1:c.-37-502_569delinsAG | |||||
HGVSg | CHROMOSOME_X:g.4868936_4871561delinsCT | ||||
Sequence_details | SMap | S_parent | Sequence | F39C12 | |
Flanking_sequences | actccacacttttctggttgaggatttgaa | ctctcaagcaccctcagtgtgtaaaattaa | |||
Mapping_target | F39C12 | ||||
Type_of_mutation | Insertion | CT | |||
Deletion | |||||
PCR_product | niDf7(X)_external | ||||
niDf7(X)_internal | |||||
SeqStatus | Sequenced | ||||
Variation_type | Natural_variant | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00033541 | ||||
Laboratory | VC | ||||
Person | WBPerson427 | ||||
Detection_method | Oligo Array CGH | ||||
Status | Live | ||||
Affects | Gene | WBGene00006640 | |||
Transcript | F39C12.3a.3 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||
VEP_impact | HIGH | ||||
HGVSc | F39C12.3a.3:c.-37-502_569delinsAG | ||||
cDNA_position | ?-755 | ||||
CDS_position | ?-569 | ||||
Protein_position | ?-190 | ||||
Intron_number | 1-6/10 | ||||
Exon_number | 2-7/11 | ||||
F39C12.3a.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||
VEP_impact | HIGH | ||||
cDNA_position | ?-606 | ||||
CDS_position | ?-569 | ||||
Protein_position | ?-190 | ||||
Intron_number | 2-5/9 | ||||
Exon_number | 1-6/10 | ||||
F39C12.3a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||
VEP_impact | HIGH | ||||
HGVSc | F39C12.3a.1:c.-37-502_569delinsAG | ||||
cDNA_position | ?-727 | ||||
CDS_position | ?-569 | ||||
Protein_position | ?-190 | ||||
Intron_number | 1-6/10 | ||||
Exon_number | 2-7/11 | ||||
F39C12.3b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||
VEP_impact | HIGH | ||||
HGVSc | F39C12.3b.1:c.36-502_641delinsAG | ||||
cDNA_position | ?-727 | ||||
CDS_position | ?-641 | ||||
Protein_position | ?-214 | ||||
Intron_number | 2-6/9 | ||||
Exon_number | 3-7/10 | ||||
Reference | WBPaper00029073 | ||||
Remark | Sequenced by the Vancouver Gene Knockout Lab (part of the C. elegans Gene Knockout Consortium) | ||||
The current sequence data supercedes the original CGH (Natural_variant) data. Original CGH data: 'Flanking_sequence TTAGAGCATTTTGCCAGCACTCTAAAGATCTCATTGCAGGTAACAGTGGA AAGTGGGTCACTCAGTAACAATTGTGTGTCTCTTTTCCCTCTACAAAACA' CGH_deleted_probes AACTCCACACTTTTCTGGTTGAGGATTTGAATTGGTACAGTTGAACTGGT GCAGATATTTCCTGTCGTGGTTTGCGTTGCTTGTGTGATGATGAGACCAC. Flanking sequences represent the nearest array oligo sequences present in the deletion chromosome on the basis of fluorescence ratio. These should not be considered hard breakpoints in the absence of actual sequence data. Original data available on-line at http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE6294 | |||||
Method | CGH_allele |