WormBase Tree Display for Variation: WBVar00091001
expand all nodes | collapse all nodes | view schema
WBVar00091001 | Evidence | Paper_evidence | WBPaper00026975 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ne2257 | |||||||
Other_name | CE00315:p.Ile173Phe | ||||||||
T05G5.3.1:c.517A>T | |||||||||
HGVSg | CHROMOSOME_III:g.9748088A>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | T05G5 | |||||
Flanking_sequences | gccgatttcggacttgccagagctattggt | tcccgattcgcgtttacacgcatgaagtga | |||||||
Mapping_target | T05G5 | ||||||||
Type_of_mutation | Substitution | a | t | Paper_evidence | WBPaper00026975 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00040431 | ||||||||
Laboratory | WM | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000405 | |||||||
Transcript | T05G5.3.1 (12) | ||||||||
Interactor | WBInteraction000502269 | ||||||||
WBInteraction000519779 | |||||||||
WBInteraction000524640 | |||||||||
WBInteraction000524644 | |||||||||
WBInteraction000525090 | |||||||||
WBInteraction000538741 | |||||||||
WBInteraction000538742 | |||||||||
Genetics | Interpolated_map_position | III | 0.968216 | ||||||
Description | Phenotype | WBPhenotype:0000822 | Paper_evidence | WBPaper00036019 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Males exhibit gonadal feminization. | Paper_evidence | WBPaper00036019 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00036019 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001133 | Paper_evidence | WBPaper00026975 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | The EMS cell underwent an aberrant left/right division, instead of a wild type anterior/posterior division (Table 1) | Paper_evidence | WBPaper00026975 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | High | 95 | Paper_evidence | WBPaper00026975 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006876 | PATO:0000460 | Paper_evidence | WBPaper00026975 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00026975 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0051301 | PATO:0000460 | Paper_evidence | WBPaper00026975 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001276 | Paper_evidence | WBPaper00026975 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Figure S2 legend: "Instead of localizing to the single germline blastomere present in 16-cell stage embryos [S3], PIE-1 protein is mislocalized in somatic blastomeres in cdk-1(ne2257) and gsk-3(RNAi) embryos." | Paper_evidence | WBPaper00026975 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004873 | PATO:0000460 | Paper_evidence | WBPaper00026975 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00026975 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | PIE-1::GFP | Paper_evidence | WBPaper00026975 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001404 | Paper_evidence | WBPaper00026975 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Figure S2 legend: "SKN-1 protein levels persist at high levels in the C-lineage of cdk-1(ne2257) and gsk-3(RNAi) embryos at the 12-cell stage, while SKN-1 staining is not observed in wild-type at this stage [S2]." | Paper_evidence | WBPaper00026975 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003810 | PATO:0000460 | Paper_evidence | WBPaper00026975 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0006875 | PATO:0000460 | Paper_evidence | WBPaper00026975 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00026975 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001636 | Paper_evidence | WBPaper00026975 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Animals exhibited C-derived gut (Table 1) | Paper_evidence | WBPaper00026975 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | 36 | Paper_evidence | WBPaper00026975 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003810 | PATO:0000460 | Paper_evidence | WBPaper00026975 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00026975 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0048565 | PATO:0000460 | Paper_evidence | WBPaper00026975 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | "C-derived gut specification was followed in laser-operated embryos." | Paper_evidence | WBPaper00026975 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001645 | Paper_evidence | WBPaper00026975 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "In wild-type animals, OMA-1 and its homolog OMA-2 accumulate during oogenesis and remain high until the 1-cell stage, but rapidly decline during the first and second mitosis [9, 10] (Figure 2 and Figure S3). We examined the timing of OMA-1 degradation by monitoring the expression of an OMA-1::GFP protein. We found that OMA-1 protein levels remain high in gsk-3, cdk-1, cks-1, and mbk-2 mutant embryos (Figure 2, Figure S3, and data not shown)." | Paper_evidence | WBPaper00026975 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
"In par-1 mutants, GFP::ZF1 protein is expressed uniformly in all blastomeres until the 2-cell stage but is degraded rapidly when the embryo divides from two to four cells. This degradation is dependent on ZIF-1. We found that in gsk-3(RNAi), cdk-1(ne2257), and oma-1(ne411gf) mutants, the GFP::ZF1 signal remains high from the 4- to 8-cell stage (Figure 6A), suggesting that stabilized OMA-1 interferes with ZIF-1-dependent proteolysis." | Paper_evidence | WBPaper00026975 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00026975 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0006508 | PATO:0000460 | Paper_evidence | WBPaper00026975 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | OMA-1::GFP | Paper_evidence | WBPaper00026975 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
par-1(RNAi) | Paper_evidence | WBPaper00026975 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_not_observed | WBPhenotype:0000354 | Paper_evidence | WBPaper00026975 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "In contrast, cdk-1(ne236), cdk-1(ne2257), and cks-1(ne549) homozygotes have no obvious larval phenotypes and produce mutant embryos with normal cell divisions and well-differentiated cells and tissues (Figure S1, data not shown)." | Paper_evidence | WBPaper00026975 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000746 | Paper_evidence | WBPaper00026975 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "In contrast, cdk-1(ne236), cdk-1(ne2257), and cks-1(ne549) homozygotes have no obvious larval phenotypes and produce mutant embryos with normal cell divisions and well-differentiated cells and tissues (Figure S1, data not shown)." | Paper_evidence | WBPaper00026975 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000750 | Paper_evidence | WBPaper00026975 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "In contrast, cdk-1(ne236), cdk-1(ne2257), and cks-1(ne549) homozygotes have no obvious larval phenotypes and produce mutant embryos with normal cell divisions and well-differentiated cells and tissues (Figure S1, data not shown)." | Paper_evidence | WBPaper00026975 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001370 | Paper_evidence | WBPaper00026975 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "We found that the CDK-1 protein encoded by the ne2257 mutant allele, CDK-1(I173F), binds to CKS-1, CYB-1, and CYB-3 as efficiently as does wild-type CDK-1 (Figures 4A, 4B, and 4E) and that both cyclin complexes recovered from cdk-1(ne2257) mutant extracts exhibit near wild-type activity toward histone H1 (Figures 4A and 4B)." | Paper_evidence | WBPaper00026975 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002213 | Paper_evidence | WBPaper00026975 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "We found that the CDK-1 protein encoded by the ne2257 mutant allele, CDK-1(I173F), binds to CKS-1, CYB-1, and CYB-3 as efficiently as does wild-type CDK-1 (Figures 4A, 4B, and 4E) and that both cyclin complexes recovered from cdk-1(ne2257) mutant extracts exhibit near wild-type activity toward histone H1 (Figures 4A and 4B)." | Paper_evidence | WBPaper00026975 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference | WBPaper00036019 | ||||||||
WBPaper00026975 | |||||||||
WBPaper00065825 | |||||||||
Method | Substitution_allele |