WormBase Tree Display for Variation: WBVar00090923
expand all nodes | collapse all nodes | view schema
| WBVar00090923 | Evidence | Person_evidence | WBPerson318 | ||
|---|---|---|---|---|---|
| Author_evidence | Hubbard EJA | ||||
| Name | Public_name | na48 | |||
| Other_name | CE03583:p.Asp211Asn | ||||
| R166.4.1:c.631G>A | |||||
| HGVSg | CHROMOSOME_II:g.10540883C>T | ||||
| Sequence_details | SMap | S_parent | Sequence | R166 | |
| Flanking_sequences | tcgaatccacgagttttatcagctggagcc | accatattgcatgtcttcattcaatttcta | |||
| Mapping_target | R166 | ||||
| Type_of_mutation | Substitution | g | a | ||
| SeqStatus | Sequenced | ||||
| Variation_type | Allele | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Strain | WBStrain00007707 | ||||
| WBStrain00007708 | |||||
| Laboratory | GC | ||||
| Status | Live | ||||
| Affects | Gene | WBGene00004185 | |||
| Transcript | R166.4.1 (12) | ||||
| Interactor (36) | |||||
| Genetics | Interpolated_map_position | II | 3.07689 | ||
| Description (2) | |||||
| Reference | WBPaper00034675 | ||||
| WBPaper00010817 | |||||
| WBPaper00026327 | |||||
| WBPaper00010789 | |||||
| Remark | pro-1(na48) is an hypomorphic allele. The Pro phenotype is most penetrant at 25 degrees yet more severe phenotypes appear at lower temperatures suggesting that the allele is cold sensitive. With regard to the Pro phenotype it is heat sensitive. RNAi experiments support this interpretation | ||||
| Method | Substitution_allele |
