WormBase Tree Display for Variation: WBVar00090769
expand all nodes | collapse all nodes | view schema
WBVar00090769 | Evidence | Paper_evidence | WBPaper00027336 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | n3767 | |||||
Other_name | CE28195:p.Gln509Ter | ||||||
CE28194:p.Gln507Ter | |||||||
ZK637.7a.1:c.1519C>T | |||||||
ZK637.7b.1:c.1525C>T | |||||||
HGVSg | CHROMOSOME_III:g.8901806G>A | ||||||
Sequence_details | SMap | S_parent | Sequence | ZK637 | |||
Flanking_sequences | aaaactatcatcgatctggaacatgtgaat | agaatatagatatcaatatgaatggaattc | |||||
Mapping_target | ZK637 | ||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00027336 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Laboratory | MT | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00002998 | |||||
Transcript | ZK637.7b.1 | VEP_consequence | stop_gained | ||||
VEP_impact | HIGH | ||||||
HGVSc | ZK637.7b.1:c.1525C>T | ||||||
HGVSp | CE28195:p.Gln509Ter | ||||||
cDNA_position | 1531 | ||||||
CDS_position | 1525 | ||||||
Protein_position | 509 | ||||||
Exon_number | 8/11 | ||||||
Codon_change | Cag/Tag | ||||||
Amino_acid_change | Q/* | ||||||
ZK637.7a.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | ||||||
HGVSc | ZK637.7a.1:c.1519C>T | ||||||
HGVSp | CE28194:p.Gln507Ter | ||||||
cDNA_position | 1525 | ||||||
CDS_position | 1519 | ||||||
Protein_position | 507 | ||||||
Exon_number | 8/11 | ||||||
Codon_change | Cag/Tag | ||||||
Amino_acid_change | Q/* | ||||||
Genetics | Interpolated_map_position | III | -0.00713971 | ||||
Reference | WBPaper00027336 | ||||||
Remark | Q(509)Amber refers to the ZK637.7a isoform | Paper_evidence | WBPaper00027336 | ||||
Method | Substitution_allele |