WormBase Tree Display for Variation: WBVar00090703
expand all nodes | collapse all nodes | view schema
WBVar00090703 | Evidence | Paper_evidence | WBPaper00032217 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | n3413 | ||||||
Other_name | CE29366:p.Arg166Trp | |||||||
Y16B4A.1.1:c.496C>T | ||||||||
HGVSg | CHROMOSOME_X:g.14777596C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | F42D1 | ||||
Flanking_sequences | gtgcttctcacacacgaagtcatgtgcagt | ggtgctgcgagaaaaagagttgtggaaatc | ||||||
Mapping_target | F42D1 | |||||||
Type_of_mutation | Substitution | c | t | |||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00027376 | |||||||
Laboratory | MT | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00006743 | ||||||
Transcript | Y16B4A.1.1 (12) | |||||||
Genetics | Interpolated_map_position | X | 21.318 | |||||
Description | Phenotype | WBPhenotype:0000643 | Paper_evidence | WBPaper00040449 | ||||
Curator_confirmed | WBPerson15063 | |||||||
WBPhenotype:0002508 | Paper_evidence | WBPaper00032217 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals have four extra fluorescent neurons in the ventral nerve cord of adults as compared to wild-type animals. | Paper_evidence | WBPaper00032217 | |||||
Curator_confirmed | WBPerson712 | |||||||
Recessive | Paper_evidence | WBPaper00032217 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | Plin-11::GFP | Paper_evidence | WBPaper00032217 | ||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000054 | Paper_evidence | WBPaper00040449 | |||||
Curator_confirmed | WBPerson15063 | |||||||
Reference | WBPaper00040449 | |||||||
WBPaper00032217 | ||||||||
Method | Substitution_allele |