WormBase Tree Display for Variation: WBVar00090654
expand all nodes | collapse all nodes | view schema
| WBVar00090654 | Name | Public_name | n3082 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Other_name | CE35714:p.Ile62GlnfsTer16 | ||||||||
| F23B12.9.1:c.182_186del | |||||||||
| HGVSg | CHROMOSOME_V:g.14431617_14431621del | ||||||||
| Sequence_details | SMap | S_parent | Sequence | F23B12 | |||||
| Flanking_sequences | CTTGGAGCCGATCTCGTAGCCGATGCTGCT | CAGAGTCATCTGAAAATTGGAATGAATTAG | |||||||
| Mapping_target | F23B12 | ||||||||
| Type_of_mutation | Deletion | GATCT | Paper_evidence | WBPaper00003077 | |||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00027341 | ||||||||
| Laboratory | MT | ||||||||
| Status | Live | ||||||||
| Linked_to | WBVar00089950 | ||||||||
| Affects | Gene | WBGene00001170 | |||||||
| Transcript | F23B12.9.1 | VEP_consequence | frameshift_variant | ||||||
| VEP_impact | HIGH | ||||||||
| HGVSc | F23B12.9.1:c.182_186del | ||||||||
| HGVSp | CE35714:p.Ile62GlnfsTer16 | ||||||||
| cDNA_position | 246-250 | ||||||||
| CDS_position | 182-186 | ||||||||
| Protein_position | 61-62 | ||||||||
| Exon_number | 4/5 | ||||||||
| Codon_change | gAGATC/g | ||||||||
| Amino_acid_change | EI/X | ||||||||
| Interactor | WBInteraction000501803 | ||||||||
| WBInteraction000571512 | |||||||||
| Genetics | Interpolated_map_position | V | 6.30731 | ||||||
| Description | Phenotype | WBPhenotype:0000182 | Paper_evidence | WBPaper00041673 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | "Loss of egl-1, ced-3, or ced-4 partially suppressed HBx-induced cell death (from 50% to 22-26% PLM death; Fig. 2A), indicating that HBx induces cell death partly through the apoptotic pathway." | Paper_evidence | WBPaper00041673 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00041673 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Phenotype_assay | Genotype | smIs98 [Pmec-3::GFP; Pmec-7::HBx] | Paper_evidence | WBPaper00041673 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Phenotype_not_observed | WBPhenotype:0001401 | Paper_evidence | WBPaper00033026 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | Mitochondria in mutant embryos embryos appeared similar to those observed in N2 embryos. Mitochondria in the germline, gut, and muscle cells of adult egl-1(lf), ced-9(lf); ced-3(lf), or ced-9(gf) mutants also appeared to be normal | Paper_evidence | WBPaper00033026 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0005772 | PATO:0000460 | Paper_evidence | WBPaper00033026 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBbt:0003675 | PATO:0000460 | Paper_evidence | WBPaper00033026 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBbt:0005784 | PATO:0000460 | Paper_evidence | WBPaper00033026 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00033026 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00033026 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Reference | WBPaper00033026 | ||||||||
| WBPaper00011512 | |||||||||
| WBPaper00041673 | |||||||||
| WBPaper00062143 | |||||||||
| WBPaper00003077 | |||||||||
| Method | Deletion_allele |
