WormBase Tree Display for Variation: WBVar00089949
expand all nodes | collapse all nodes | view schema
WBVar00089949 | Name | Public_name | n1084 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | n487 | Paper_evidence | WBPaper00003631 | ||||||
n1796 | Paper_evidence | WBPaper00003631 | |||||||
Sequence_details | SMap | S_parent | Sequence | VF23B12L | |||||
Flanking_sequences | TATTGGGTATTGTTTACTCCTAACCGGGTG | TCCATAAAATTCTATTGTCCCAGATTTAGG | |||||||
Mapping_target | VF23B12L | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00003631 | ||||
Person_evidence | WBPerson117 | ||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00026954 | ||||||||
WBStrain00027341 | |||||||||
Laboratory | MT | ||||||||
Status | Live | ||||||||
Linked_to | WBVar00089950 | ||||||||
Affects | Gene | WBGene00001170 | |||||||
Genetics | Interpolated_map_position | V | 6.30574 | ||||||
Description | Phenotype | WBPhenotype:0000006 | Paper_evidence | WBPaper00001133 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | The penetrance of the egg-laying defect in n1084 heterozygotes is heat-sensitive. See Table 7 | Paper_evidence | WBPaper00001133 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | High | As shown in Table 5, 74 percent of heterozygotes are Egl. Under homozygous conditions, 98 percent of hermaphrodites are Egl | Paper_evidence | WBPaper00001133 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Dominant | Paper_evidence | WBPaper00001133 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001133 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Temperature | 20 | Paper_evidence | WBPaper00001133 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000154 | Paper_evidence | WBPaper00001133 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants show a 37 percent drop in brood size (compared to wild-type) | Paper_evidence | WBPaper00001133 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Dominant | Paper_evidence | WBPaper00001133 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001133 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Temperature | 20 | Paper_evidence | WBPaper00001133 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000339 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | weaker than allele than n487 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001172 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | weaker than allele than n487 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006830 | PATO:0000460 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001220 | Paper_evidence | WBPaper00001133 | |||||||
WBPaper00001105 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | HSNs (which normally undergo apoptosis only in males) die in the mutant hermaphrodites. Authors comment it seems likely that egl-1 mutations cause the cell-specific sexual transformation of hermaphrodite HSNs. | Paper_evidence | WBPaper00001133 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
HSNs undergo embryonic apoptosis in hermaphrodites. | Paper_evidence | WBPaper00001105 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Dominant | Paper_evidence | WBPaper00001133 | |||||||
WBPaper00001105 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006830 | PATO:0000460 | Paper_evidence | WBPaper00001133 | ||||
WBPaper00001105 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00001105 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001340 | Paper_evidence | WBPaper00001133 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
Remark | See Table 1 | Paper_evidence | WBPaper00001133 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
weaker than allele than n487 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance (2) | |||||||||
Dominant | Paper_evidence | WBPaper00001133 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001133 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | 0.75 mg/ml imipramine | Paper_evidence | WBPaper00001133 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature | 24 | Paper_evidence | WBPaper00001133 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_not_observed (2) | |||||||||
Reference (12) | |||||||||
Method | Substitution_allele |