WormBase Tree Display for Variation: WBVar00089928
expand all nodes | collapse all nodes | view schema
| WBVar00089928 | Evidence | Paper_evidence | WBPaper00031858 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | n1057 | |||||||
| Other_name | CE32786:p.Asp20Asn | ||||||||
| B0001.1a.1:c.58G>A | |||||||||
| HGVSg | CHROMOSOME_IV:g.12129564G>A | ||||||||
| Sequence_details | SMap | S_parent | Sequence | B0001 | |||||
| Flanking_sequences | tctcgaagactatgcatggcaccaattccaa | atgtgcagtcacttcgaaagactcgaatcga | |||||||
| Mapping_target | B0001 | ||||||||
| Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00031858 | ||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Laboratory | MT | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00003010 | |||||||
| Transcript | B0001.1a.1 (12) | ||||||||
| Genetics | Interpolated_map_position | IV | 5.73106 | ||||||
| Mapping_data | In_multi_point | 1794 | |||||||
| 1796 | |||||||||
| 1798 | |||||||||
| 1800 | |||||||||
| 1802 | |||||||||
| In_pos_neg_data | 5123 | ||||||||
| Description | Phenotype | WBPhenotype:0000006 | Paper_evidence | WBPaper00000762 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Semi_dominant | Paper_evidence | WBPaper00000762 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00000762 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_assay | Temperature | 20 | Paper_evidence | WBPaper00000762 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Genotype | n1057/+ | Paper_evidence | WBPaper00000762 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0000640 | Person_evidence | WBPerson261 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | Non-null, n1057 and n1057/Df are wildtype, n1057/+ is 33% Egl. | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Dominant | Person_evidence | WBPerson261 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000698 | Paper_evidence | WBPaper00000762 | |||||||
| WBPaper00031858 | |||||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPerson190 | |||||||||
| Penetrance | Incomplete | 33 percent of n1057 heterozygotes are Vul. n1057 homozygotes are phenotypically wild-type | Paper_evidence | WBPaper00000762 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Paper_evidence | WBPaper00031858 | ||||||||
| Curator_confirmed | WBPerson190 | ||||||||
| Semi_dominant | Paper_evidence | WBPaper00000762 | |||||||
| WBPaper00031858 | |||||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPerson190 | |||||||||
| EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00000762 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_assay | Temperature | 20 | Paper_evidence | WBPaper00000762 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Genotype | n1057/+ | Paper_evidence | WBPaper00000762 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0000729 | Paper_evidence | WBPaper00000762 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | Ectopic cell deaths in ventral hypodermal cells | Paper_evidence | WBPaper00000762 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Anatomy_term | WBbt:0008125 | PATO:0000460 | Paper_evidence | WBPaper00000762 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00000762 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Reference | WBPaper00021687 | ||||||||
| WBPaper00031858 | |||||||||
| WBPaper00000762 | |||||||||
| Method | Substitution_allele |
