WormBase Tree Display for Variation: WBVar00089737
expand all nodes | collapse all nodes | view schema
WBVar00089737 | Evidence | Paper_evidence | WBPaper00003632 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | n766 | |||||
Other_name | CE30992:p.Tyr796Ter | ||||||
F44B9.6.1:c.2388T>A | |||||||
HGVSg | CHROMOSOME_III:g.8017886A>T | ||||||
Sequence_details | SMap | S_parent | Sequence | F44B9 | |||
Flanking_sequences | ttcaacttccatatccgttgctggaatcag | tactcatcagaaacaaccaccggagaagat | |||||
Mapping_target | F44B9 | ||||||
Type_of_mutation | Substitution | a | t | Curator_confirmed | WBPerson4055 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin (4) | |||||||
Affects | Gene | WBGene00003021 | |||||
Transcript | F44B9.6.1 | VEP_consequence | stop_gained | ||||
VEP_impact | HIGH | ||||||
HGVSc | F44B9.6.1:c.2388T>A | ||||||
HGVSp | CE30992:p.Tyr796Ter | ||||||
cDNA_position | 2391 | ||||||
CDS_position | 2388 | ||||||
Protein_position | 796 | ||||||
Exon_number | 9/12 | ||||||
Codon_change | taT/taA | ||||||
Amino_acid_change | Y/* | ||||||
Interactor (42) | |||||||
Isolation | Mutagen | EMS | Paper_evidence | WBPaper00003632 | |||
Genetics | Interpolated_map_position | III | -0.446789 | ||||
Mapping_data | In_multi_point | 874 | |||||
875 | |||||||
876 | |||||||
877 | |||||||
878 | |||||||
1098 | |||||||
1105 | |||||||
1107 | |||||||
1886 | |||||||
In_pos_neg_data | 4346 | ||||||
Description | Phenotype_not_observed (3) | ||||||
Reference | WBPaper00021002 | ||||||
WBPaper00014834 | |||||||
WBPaper00038168 | |||||||
WBPaper00027135 | |||||||
WBPaper00016177 | |||||||
WBPaper00014833 | |||||||
WBPaper00016178 | |||||||
WBPaper00010946 | |||||||
WBPaper00044900 | |||||||
Remark | Variation flanks and nucleotide change automatically updated to be on the positive strand to fix mapping and gff dumping issues. | ||||||
[200224 mh6] reverse complemented/swapped the change and flanks to move the variation onto the plus strand | Curator_confirmed | WBPerson4055 | |||||
Method | Substitution_allele |