WormBase Tree Display for Variation: WBVar00088953
expand all nodes | collapse all nodes | view schema
WBVar00088953 | Evidence | Paper_evidence | WBPaper00035199 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | mg375 | ||||||
Other_name | mg374Eri | Paper_evidence | WBPaper00035199 | |||||
CE47418:p.Gly492Arg | ||||||||
K12H4.8.1:c.1474G>A | ||||||||
HGVSg | CHROMOSOME_III:g.8077980C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | K12H4 | ||||
Flanking_sequences | acttgacatgagatcatacgttcagtcaaag | gaagagctcggcgagctggatcaagatatgt | ||||||
Mapping_target | K12H4 | |||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00035199 | |||
Person_evidence | WBPerson315 | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00040753 | |||||||
WBStrain00040767 | ||||||||
Laboratory | GR | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00000939 | ||||||
Transcript | K12H4.8.1 (12) | |||||||
Genetics | Interpolated_map_position | III | -0.385289 | |||||
Description | Phenotype | WBPhenotype:0000136 | Paper_evidence | WBPaper00035199 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | mRNA levels of siRNA target genes are increased compared to control animals. This increase in mRNA levels include those for sperm-specific siRNA target gene ssp-19, C25G4.6, and F18C5.4, defining this gene as a class I Eri factor. | Paper_evidence | WBPaper00035199 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000154 | Paper_evidence | WBPaper00035199 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000390 | Paper_evidence | WBPaper00035199 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | In vivo activation of spermatids was defective as spermatids failed to localize to the spermatheca. | Paper_evidence | WBPaper00035199 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00035199 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals are ts sterile. | Paper_evidence | WBPaper00035199 | |||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00035199 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000693 | Paper_evidence | WBPaper00035199 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Spermatids were unable to form pseudopods and exhibited aberrant morphology. | Paper_evidence | WBPaper00035199 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000812 | Paper_evidence | WBPaper00035199 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001175 | Paper_evidence | WBPaper00035199 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001258 | Paper_evidence | WBPaper00035199 | ||||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001776 | Paper_evidence | WBPaper00035199 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals fail to express endo siRNAs. | Paper_evidence | WBPaper00035199 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000039 | Paper_evidence | WBPaper00041520 | |||||
Curator_confirmed | WBPerson19150 | |||||||
WBPhenotype:0000139 | Paper_evidence | WBPaper00041520 | ||||||
Curator_confirmed | WBPerson19150 | |||||||
WBPhenotype:0001759 | Paper_evidence | WBPaper00035199 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals retain the ability to express this class of small regulatory RNAs. | Paper_evidence | WBPaper00035199 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001779 | Paper_evidence | WBPaper00035199 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals retain the ability to express this class of small regulatory RNAs. | Paper_evidence | WBPaper00035199 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00041184 | |||||||
WBPaper00041520 | ||||||||
WBPaper00035199 | ||||||||
Method | Substitution_allele |