WormBase Tree Display for Variation: WBVar00088867
expand all nodes | collapse all nodes | view schema
| WBVar00088867 | Evidence | Paper_evidence | WBPaper00005462 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | me17 | |||||
| Other_name | CE33925:p.Gln74Ter | ||||||
| F26D2.2.1:c.220C>T | |||||||
| HGVSg | CHROMOSOME_V:g.16405982C>T | ||||||
| Sequence_details | SMap | S_parent | Sequence | F26D2 | |||
| Flanking_sequences | gagctggcttctcaagttcaaaccgagtcg | aacgaatgcatgatataaagaaggagctta | |||||
| Mapping_target | F26D2 | ||||||
| Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00005462 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00000290 | ||||||
| Laboratory | AV | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00006375 | |||||
| Transcript | F26D2.2.1 | VEP_consequence | stop_gained | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | F26D2.2.1:c.220C>T | ||||||
| HGVSp | CE33925:p.Gln74Ter | ||||||
| cDNA_position | 1709 | ||||||
| CDS_position | 220 | ||||||
| Protein_position | 74 | ||||||
| Exon_number | 2/8 | ||||||
| Codon_change | Caa/Taa | ||||||
| Amino_acid_change | Q/* | ||||||
| Genetics | Interpolated_map_position | V | 10.0424 | ||||
| Mapping_data | In_multi_point | 4776 | |||||
| Description | Phenotype | WBPhenotype:0001370 | Paper_evidence | WBPaper00039957 | |||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | Western blot analysis of a wild type precipitate using a SYP-1 antibody revealed a pull down of both SYP-2 and SYP-1. Control IPs with lysates from null mutants did not reveal similar results. | Paper_evidence | WBPaper00039957 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Reference | WBPaper00039957 | ||||||
| WBPaper00005462 | |||||||
| WBPaper00023404 | |||||||
| WBPaper00064969 | |||||||
| WBPaper00065266 | |||||||
| WBPaper00065293 | |||||||
| Method | Substitution_allele |
