WormBase Tree Display for Variation: WBVar00088257
expand all nodes | collapse all nodes | view schema
WBVar00088257 | Evidence | Person_evidence | WBPerson508 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | kn1 | |||||
Other_name | T07C4.7a.1:c.212G>A | ||||||
CE50785:p.Gly4Glu | |||||||
CE00598:p.Gly71Glu | |||||||
T07C4.7b.1:c.11G>A | |||||||
HGVSg | CHROMOSOME_III:g.10334600G>A | ||||||
Sequence_details | SMap | S_parent | Sequence | T07C4 | |||
Flanking_sequences | ACCAGCCACAATTGACCTGGATGCTCTCCG | ATTCCATAGAATCAGCGGTTGTGTAATGGC | |||||
Mapping_target | T07C4 | ||||||
Type_of_mutation | Substitution | g | a | Person_evidence (2) | |||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00034909 | ||||||
WBStrain00034917 | |||||||
Laboratory | TK | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00003225 | |||||
Transcript | T07C4.7b.1 (12) | ||||||
T07C4.7a.1 (12) | |||||||
Interactor (12) | |||||||
Genetics | Interpolated_map_position | III | 2.34584 | ||||
Mapping_data | In_multi_point | 1752 | |||||
1753 | |||||||
1754 | |||||||
1755 | |||||||
1756 | |||||||
1757 | |||||||
1824 | |||||||
2407 | |||||||
Description | Phenotype (24) | ||||||
Phenotype_not_observed | WBPhenotype:0000039 | Paper_evidence | WBPaper00031688 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000460 | Paper_evidence | WBPaper00031688 | |||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000636 | Paper_evidence | WBPaper00045008 | |||||
Curator_confirmed | WBPerson298 | ||||||
Remark | no change in axon degeneration of severed GABA motor neuron axons. | Paper_evidence | WBPaper00045008 | ||||
Curator_confirmed | WBPerson298 | ||||||
EQ_annotations | Anatomy_term (2) | ||||||
WBPhenotype:0000686 | Paper_evidence | WBPaper00040524 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | mev-1(kn1) mutants showed increased levels of mtROS when compared to wildtype worms. | Paper_evidence | WBPaper00040524 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0001871 | Paper_evidence | WBPaper00040161 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | The short lived mitochondrial mutant mev-1 was found to be short-lived on 100 uM FUdR plates. | Paper_evidence | WBPaper00040161 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0001991 | Paper_evidence | WBPaper00034694 | |||||
Curator_confirmed | WBPerson2857 | ||||||
Remark | animals enter into hypoxia-induced reproductive and developmental diapause same as wild-type | Paper_evidence | WBPaper00034694 | ||||
Curator_confirmed | WBPerson2857 | ||||||
Reference (34) | |||||||
Remark | Allele sequenced by James Rand and Ellie Mathews | ||||||
Method | Substitution_allele |