WormBase Tree Display for Variation: WBVar00088161
expand all nodes | collapse all nodes | view schema
WBVar00088161 | Evidence | Paper_evidence | WBPaper00006431 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ju145 | |||||||
Other_name | CE38293:p.Gln260Ter | ||||||||
C41G7.5b.1:c.778C>T | |||||||||
CE20561:p.Gln302Ter | |||||||||
C41G7.5a.1:c.904C>T | |||||||||
HGVSg | CHROMOSOME_I:g.9529104C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | C41G7 | |||||
Flanking_sequences | cagttggatggagctttagtatctatggat | aaaagtgagttttattaggtaaaaataact | |||||||
Mapping_target | C41G7 | ||||||||
Type_of_mutation | Substitution | c | t | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00005374 | ||||||||
Laboratory | CZ | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000096 | |||||||
Transcript | C41G7.5b.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | C41G7.5b.1:c.778C>T | ||||||||
HGVSp | CE38293:p.Gln260Ter | ||||||||
cDNA_position | 866 | ||||||||
CDS_position | 778 | ||||||||
Protein_position | 260 | ||||||||
Exon_number | 7/13 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
C41G7.5a.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | C41G7.5a.1:c.904C>T | ||||||||
HGVSp | CE20561:p.Gln302Ter | ||||||||
cDNA_position | 932 | ||||||||
CDS_position | 904 | ||||||||
Protein_position | 302 | ||||||||
Exon_number | 8/15 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
Interactor (16) | |||||||||
Genetics | Interpolated_map_position | I | 3.79478 | ||||||
Description | Phenotype | WBPhenotype:0000061 | Paper_evidence | WBPaper00060797 | |||||
WBPaper00064073 | |||||||||
WBPaper00049229 | |||||||||
Curator_confirmed | WBPerson3983 | ||||||||
WBPerson30364 | |||||||||
WBPhenotype:0000625 | Paper_evidence | WBPaper00006431 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | In ahr-1(ju145), fewer synapses were made between RMEL/R and head muscles | Paper_evidence | WBPaper00006431 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00006431 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005025 | PATO:0000460 | Paper_evidence | WBPaper00006431 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0005023 | PATO:0000460 | Paper_evidence | WBPaper00006431 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | juIs1 [unc-25p::SNB-1-GFP] | Paper_evidence | WBPaper00006431 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001331 | Paper_evidence | WBPaper00006431 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | RMEL and RMER exhibited abnormal cell morphology such that, each extended an ectopic process of variable length growing along the lateral side of the body | Paper_evidence | WBPaper00006431 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00006431 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005025 | PATO:0000460 | Paper_evidence | WBPaper00006431 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0005023 | PATO:0000460 | Paper_evidence | WBPaper00006431 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | GABA antibody staining | Paper_evidence | WBPaper00006431 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Genotype | juIs76 [unc-25p::GFP], oxIs12 [unc-47pfl::GFP] | Paper_evidence | WBPaper00006431 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001510 | Paper_evidence | WBPaper00006431 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | ahr-1(ju145) mutation alters multiple differentiated features of RMEL/R and transforms them into RMED/V-like neurons. | Paper_evidence | WBPaper00006431 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00006431 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005025 | PATO:0000460 | Paper_evidence | WBPaper00006431 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0005023 | PATO:0000460 | Paper_evidence | WBPaper00006431 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | juEx517 [avr-15p::GFP], vbEx1 [clh-6p::GFP], nuIs25 [glr-1p::GFP], otEx406 [lim-6p::GFP], otIs37 [unc-47ps::GFP] | Paper_evidence | WBPaper00006431 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0002261 | Paper_evidence | WBPaper00042557 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | ahr-1 mutants display a phenotype similar to aha-1 mutants. | Paper_evidence | WBPaper00042557 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00042557 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006826 | PATO:0000460 | Paper_evidence | WBPaper00042557 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005490 | PATO:0000460 | Paper_evidence | WBPaper00042557 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0001765 | Paper_evidence | WBPaper00031936 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | AHR-1 mutants respond normally to CO2 | Paper_evidence | WBPaper00031936 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00031936 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | 10% CO2 | Paper_evidence | WBPaper00031936 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Disease_info | Modifies_disease | DOID:1289 | |||||||
Modifies_disease_in_annotation | WBDOannot00001389 | ||||||||
WBDOannot00001390 | |||||||||
Reference | WBPaper00006431 | ||||||||
WBPaper00031936 | |||||||||
WBPaper00042557 | |||||||||
WBPaper00060797 | |||||||||
WBPaper00049229 | |||||||||
WBPaper00064073 | |||||||||
Method | Substitution_allele |