WormBase Tree Display for Variation: WBVar00088136
expand all nodes | collapse all nodes | view schema
WBVar00088136 | Name | Public_name | ju2 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name (5) | |||||||||
HGVSg | CHROMOSOME_II:g.7588281G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | R07G3 | |||||
Flanking_sequences | taaacttttttgttttcagagcaacaattt | gattgtctaatggaagtccgggaagaactg | |||||||
Mapping_target | R07G3 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00005543 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | CZ | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006363 | |||||||
Transcript | F35D2.5c.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F35D2.5c.1:c.673C>T | ||||||||
HGVSp | CE33392:p.Arg225Ter | ||||||||
cDNA_position | 676 | ||||||||
CDS_position | 673 | ||||||||
Protein_position | 225 | ||||||||
Exon_number | 6/11 | ||||||||
Codon_change | Cga/Tga | ||||||||
Amino_acid_change | R/* | ||||||||
F35D2.5a.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F35D2.5a.1:c.1471C>T | ||||||||
HGVSp | CE33391:p.Arg491Ter | ||||||||
cDNA_position | 1475 | ||||||||
CDS_position | 1471 | ||||||||
Protein_position | 491 | ||||||||
Exon_number | 14/19 | ||||||||
Codon_change | Cga/Tga | ||||||||
Amino_acid_change | R/* | ||||||||
F35D2.5c.2 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | F35D2.5c.2:c.673C>T | ||||||||
HGVSp | CE33392:p.Arg225Ter | ||||||||
cDNA_position | 1249 | ||||||||
CDS_position | 673 | ||||||||
Protein_position | 225 | ||||||||
Exon_number | 11/16 | ||||||||
Codon_change | Cga/Tga | ||||||||
Amino_acid_change | R/* | ||||||||
Interactor (20) | |||||||||
Isolation | Mutagen | EMS | Paper_evidence | WBPaper00005543 | |||||
Genetics | Interpolated_map_position | II | 0.504799 | ||||||
Mapping_data | In_multi_point | 4715 | |||||||
Description | Phenotype | WBPhenotype:0000566 | Paper_evidence | WBPaper00005543 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | syd-1 mutant animals coiled ventrally when they moved backwards. | Paper_evidence | WBPaper00005543 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00005543 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000847 | Paper_evidence | WBPaper00005543 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | There were fewer ventral SNB-1::GFP puncta in mutants than in wild-type animals, and they were slightly irregular in shape. In dorsal cords, the number of puncta was comparable to wild type; however the puncta shape were noticeably abnormal. | In syd-1 mutants, only 3-7 SNB::GFP puncta in ASI axons were observed and distinct SNB::GFP puncta in dendritic regions were detected. | Paper_evidence | WBPaper00005543 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00005543 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term (3) | ||||||||
Phenotype_assay | Genotype | juIs1[Punc-25::SNB-1::GFP] | Paper_evidence | WBPaper00005543 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000905 | Paper_evidence | WBPaper00005543 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The overall morphology of DDs and VDs was normal; however, mild abnormalities in ASI were observed, where a single process first emerged from the cell bodies and later branched to form an axon and dendrite, and the axon extended farther posteriorly before looping into the nerve ring. | Paper_evidence | WBPaper00005543 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00005543 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005666 | PATO:0000460 | Paper_evidence | WBPaper00005543 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001801 | Paper_evidence | WBPaper00005543 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | syd-1 affects the polarity of ASI neurons. | Paper_evidence | WBPaper00005543 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00005543 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005666 | PATO:0000460 | Paper_evidence | WBPaper00005543 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002232 | Paper_evidence | WBPaper00005543 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Polarity of L1 DDs is disrupted in the same way as in the adult VDs in syd-1 mutants; however despite initial polarity defects in juvenile DDs, the polarity of adult DDs seems normal in syd-1 mutants. | Paper_evidence | WBPaper00005543 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Loss_of_function_undetermined_extent | Paper_evidence | WBPaper00005543 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005303 | PATO:0000460 | Paper_evidence | WBPaper00005543 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00005543 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00005543 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000944 | Paper_evidence | WBPaper00005543 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Loss of syd-1 function causes morphologically normal axonal specializations to form in the dendritic processes of VDs, based on ultrastructural analysis of VD dorsal process presynaptic specializations and placement of postsynaptic muscle arm membranes. | Paper_evidence | WBPaper00005543 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002262 | Paper_evidence | WBPaper00005543 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | postsynaptic localization of an AMPA-type glutamate receptor marker, GLR-1::GFP was unaltered. | Paper_evidence | WBPaper00005543 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term (2) | ||||||||
Reference | WBPaper00005543 | ||||||||
Remark | Flanking sequences refer to F35D2.5c isoform | Curator_confirmed | WBPerson1845 | ||||||
Method | Substitution_allele |