WormBase Tree Display for Variation: WBVar00088091

WBVar00088091 Name: Public_name: jh101
    Other_name: Y38A10A.5.1:c.322-37_*97del
    HGVSg: CHROMOSOME_V:g.6099075_6100130del
  Sequence_details: SMap: S_parent: Sequence: Y38A10A
    Flanking_sequences: aattttttcgcattagtttgttagtatcaa tgattgttttattaatttattgagcatcca
    Mapping_target: Y38A10A
    Type_of_mutation: Deletion
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00023525
    Laboratory: KJ
    Status: Live
  Affects: Gene: WBGene00000802
      WBGene00021391
    Transcript: Y38A10A.6.1 VEP_consequence: 3_prime_UTR_variant
        VEP_impact: MODIFIER
        cDNA_position: 1747-?
        Exon_number: 6/6
      Y38A10A.5.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,3_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: Y38A10A.5.1:c.322-37_*97del
        cDNA_position: ?-1318
        Intron_number: 2-3/4
        Exon_number: 3-5/5
    Interactor: WBInteraction000502301
      WBInteraction000502302
  Genetics: Interpolated_map_position: V -0.354219
    Mapping_data: In_multi_point: 4240
  Description: Phenotype: WBPhenotype:0000154 Paper_evidence: WBPaper00026928
        Curator_confirmed: WBPerson2021
        Remark: crt-1 mutants showed a lower brood size at 20 C and a significantly decreased brood size at 25 C, compared to those of wild-type animals Paper_evidence: WBPaper00026928
            Curator_confirmed: WBPerson2021
        Temperature_sensitive: Heat_sensitive: 25C Paper_evidence: WBPaper00026928
              Curator_confirmed: WBPerson2021
        Phenotype_assay: Temperature: 20C, 25C Paper_evidence: WBPaper00026928
              Curator_confirmed: WBPerson2021
      WBPhenotype:0001485 Paper_evidence: WBPaper00026928
        Curator_confirmed: WBPerson2021
        Remark: Mutant animals are hypersensitive to EGTA and DTT (inducers of ER stress) Paper_evidence: WBPaper00026928
            Curator_confirmed: WBPerson2021
        Phenotype_assay: Treatment: 0-10mM of EGTA or DTT Paper_evidence: WBPaper00026928
              Curator_confirmed: WBPerson2021
      WBPhenotype:0001719 Paper_evidence: WBPaper00030877
        Curator_confirmed: WBPerson2021
        Remark: In the absence of CRT-1, normal development was significantly affected when the worms undergo ER stress Paper_evidence: WBPaper00030877
            Curator_confirmed: WBPerson2021
        Variation_effect: Null: Paper_evidence: WBPaper00030877
            Curator_confirmed: WBPerson2021
        EQ_annotations: Life_stage: WBls:0000023 PATO:0000460 Paper_evidence: WBPaper00030877
                Curator_confirmed: WBPerson2021
        Phenotype_assay: Treatment: Analysis of crt-1 expression under TM (30 ug/ml) stress Paper_evidence: WBPaper00030877
              Curator_confirmed: WBPerson2021
      WBPhenotype:0001724 Paper_evidence: WBPaper00030877
          WBPaper00026928
        Curator_confirmed: WBPerson2021
        Remark: The crt-1(jh101) mutants are hypersensitive to TM stress. The arrested larvae had many vacuole-like structures in their body, which are indicative of necrotic cell death Paper_evidence: WBPaper00030877
            Curator_confirmed: WBPerson2021
          Mutants were severely affected by tunicamycin Paper_evidence: WBPaper00026928
            Curator_confirmed: WBPerson2021
        Variation_effect: Null: Paper_evidence: WBPaper00030877
            Curator_confirmed: WBPerson2021
        EQ_annotations: Life_stage: WBls:0000023 PATO:0000460 Paper_evidence: WBPaper00030877
                Curator_confirmed: WBPerson2021
        Phenotype_assay: Treatment: For the TM sensitivity assay, gravid adult worms of indicated strain were allowed to lay eggs on plates containing various amount of TM (0, 2, 5, or 10 ug/ml) for 4 h, after which the adults were removed from the plates. The developmental stages of the worms were examined after three days Paper_evidence: WBPaper00030877
              Curator_confirmed: WBPerson2021
            0-7.5 ug/ml of tunicamycin Paper_evidence: WBPaper00026928
              Curator_confirmed: WBPerson2021
  Reference: WBPaper00026928
    WBPaper00030877
  Remark: Deletion endpoints are approximate and are estimated from Figure 1A of paper which notes the deletion covering 1.1 kb of sequence. [030507 krb] Paper_evidence: WBPaper00004858
  Method: Deletion_allele