WormBase Tree Display for Variation: WBVar00087894
expand all nodes | collapse all nodes | view schema
| WBVar00087894 | Evidence | Paper_evidence | WBPaper00035972 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | hj21 | |||||
| Other_name | C34E10.4b.2:c.-374-531G>A | ||||||
| C34E10.4a.2:c.333+1G>A | |||||||
| C34E10.4a.1:c.333+1G>A | |||||||
| C34E10.4b.1:c.-615+1G>A | |||||||
| C34E10.4b.4:c.-615+1G>A | |||||||
| C34E10.4b.3:c.-530+1G>A | |||||||
| HGVSg | CHROMOSOME_III:g.5237184G>A | ||||||
| Sequence_details | SMap | S_parent | Sequence | C34E10 | |||
| Flanking_sequences | tttccattaatttcaaattatttgattcag | tgattttcatagtttctttttgaaaatatt | |||||
| Mapping_target | C34E10 | ||||||
| Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00035972 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Laboratory | VS | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00305300 | |||||
| WBGene00006946 | |||||||
| Transcript | C34E10.4b.3 | VEP_consequence | splice_donor_variant | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | C34E10.4b.3:c.-530+1G>A | ||||||
| Intron_number | 2/11 | ||||||
| C34E10.4a.2 | VEP_consequence | splice_donor_variant | |||||
| VEP_impact | HIGH | ||||||
| HGVSc | C34E10.4a.2:c.333+1G>A | ||||||
| Intron_number | 4/11 | ||||||
| C34E10.4a.1 | VEP_consequence | splice_donor_variant | |||||
| VEP_impact | HIGH | ||||||
| HGVSc | C34E10.4a.1:c.333+1G>A | ||||||
| Intron_number | 4/12 | ||||||
| C34E10.13 | |||||||
| C34E10.4b.4 | VEP_consequence | splice_donor_variant | |||||
| VEP_impact | HIGH | ||||||
| HGVSc | C34E10.4b.4:c.-615+1G>A | ||||||
| Intron_number | 1/10 | ||||||
| C34E10.4b.1 | VEP_consequence | splice_donor_variant | |||||
| VEP_impact | HIGH | ||||||
| HGVSc | C34E10.4b.1:c.-615+1G>A | ||||||
| Intron_number | 2/11 | ||||||
| C34E10.4b.2 | VEP_consequence | intron_variant | |||||
| VEP_impact | MODIFIER | ||||||
| HGVSc | C34E10.4b.2:c.-374-531G>A | ||||||
| Intron_number | 1/9 | ||||||
| Genetics | Interpolated_map_position | III | -1.86389 | ||||
| Description | Phenotype | WBPhenotype:0000436 | Paper_evidence | WBPaper00035972 | |||
| Curator_confirmed | WBPerson2021 | ||||||
| Remark | In prx-10(hj21) mutant animals, a monomeric red fluorescent protein (mRFP) bearing the canonical type-1 peroxisomal targeting signal (PTS1), or a GFP-tagged DAF-22/thiolase fusion protein were retained in the cytoplasm | Paper_evidence | WBPaper00035972 | ||||
| Curator_confirmed | WBPerson2021 | ||||||
| Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035972 | ||||
| Curator_confirmed | WBPerson2021 | ||||||
| WBPhenotype:0001888 | Paper_evidence | WBPaper00035972 | |||||
| Curator_confirmed | WBPerson2021 | ||||||
| Remark | Mutant animals show intense staining of C1-BODIPY-C12 that accumulates in enlarged spherical intracellular structures. Oil-Red-O staining confirmed that the enlarged spherical intracellular structures in the mutant intestine are sites of fat storage (lipid droplets) | Paper_evidence | WBPaper00035972 | ||||
| Curator_confirmed | WBPerson2021 | ||||||
| Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035972 | ||||
| Curator_confirmed | WBPerson2021 | ||||||
| Disease_info | Models_disease | DOID:9970 | |||||
| Models_disease_in_annotation | WBDOannot00000573 | ||||||
| Reference | WBPaper00035972 | ||||||
| Method | Substitution_allele |
