WormBase Tree Display for Variation: WBVar00054712
expand all nodes | collapse all nodes | view schema
WBVar00054712 | Evidence | Paper_evidence | WBPaper00026706 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | cw49 | |||||||
Other_name | CE39149:p.Trp330Ter | ||||||||
F27E11.3.1:c.990G>A | |||||||||
HGVSg | CHROMOSOME_V:g.3443234C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | F27E11 | |||||
Flanking_sequences | tttcttcggaatggctgcctcggtttggtg | gtgatcctttcgctaacctgggtgctgtcg | |||||||
Mapping_target | F27E11 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00026706 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | WF | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000478 | |||||||
Transcript | F27E11.3.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | F27E11.3.1:c.990G>A | ||||||||
HGVSp | CE39149:p.Trp330Ter | ||||||||
cDNA_position | 992 | ||||||||
CDS_position | 990 | ||||||||
Protein_position | 330 | ||||||||
Exon_number | 3/6 | ||||||||
Codon_change | tgG/tgA | ||||||||
Amino_acid_change | W/* | ||||||||
Genetics | Interpolated_map_position | V | -11.6715 | ||||||
Description | Phenotype | WBPhenotype:0000232 | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Among the mutations that we isolated was cw49, which caused defects in both CAN and HSN cell migration... By analogy to other mutations in Frizzleds as well as other serpentine receptors, both cfz-2 mutations are predicted to reduce or eliminate gene function (Chen et al., 2004; Heymann and Subramaniam, 1997; Ray et al., 1997; Sawa et al., 1996; Unson et al., 1995). Consistent with this, both mutations are recessive... Ironically, although cfz-2(cw49) was isolated in a screen for CAN and HSN cell migration defects, after backcrossing to remove unlinked mutations and the kal-1::gfp reporter transgene, CAN and HSN migrations are nearly normal (Fig. 5, Table 1). The kal-1::gfp reporter transgene apparently is responsible for this enhancement; crossing it back into outcrossed cfz-1(cw49) mutants restores the CAN migration defects (not shown)." | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Low | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Recessive | Paper_evidence | WBPaper00026706 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Predicted_hypomorph_via_sequence | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006827 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | "A CAN was scored as anteriorly misplaced (Ant.) if its nucleus was anterior to the V3 nucleus and posteriorly misplaced (Post.) if posterior to the V4 nucleus." | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Genotype | kal-1::gfp | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000469 | Paper_evidence | WBPaper00026706 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "QL and its descendants migrate posteriorly whereas QR and its descendants migrate anteriorly (Fig. 1; Sulston and Horvitz, 1977). In cfz-2 mutants, the migrations of QR descendants terminated posterior to their normal position 11.8% of the time (Fig. 4, Table 1). QL descendant migration in cfz-2 mutants is indistinguishable from wild type (Table 1)." | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | 12 | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004991 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0003832 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | "A QR cell descendant was scored as defective if its nucleus was posterior to the V2.a nucleus. Because they occupy positions near each other, the data for SDQR and AVM were combined. The position of AQR, a third QR descendant, was not included because it migrates to a location near other nuclei with similar morphology." | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000470 | Paper_evidence | WBPaper00026706 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Among the mutations that we isolated was cw49, which caused defects in both CAN and HSN cell migration... By analogy to other mutations in Frizzleds as well as other serpentine receptors, both cfz-2 mutations are predicted to reduce or eliminate gene function (Chen et al., 2004; Heymann and Subramaniam, 1997; Ray et al., 1997; Sawa et al., 1996; Unson et al., 1995). Consistent with this, both mutations are recessive... Ironically, although cfz-2(cw49) was isolated in a screen for CAN and HSN cell migration defects, after backcrossing to remove unlinked mutations and the kal-1::gfp reporter transgene, CAN and HSN migrations are nearly normal (Fig. 5, Table 1). The kal-1::gfp reporter transgene apparently is responsible for this enhancement; crossing it back into outcrossed cfz-1(cw49) mutants restores the CAN migration defects (not shown)." | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Low | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Recessive | Paper_evidence | WBPaper00026706 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Variation_effect | Predicted_hypomorph_via_sequence | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006830 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | "An HSN was scored as defective if its nucleus was posterior to the V4 nucleus." | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Genotype | kal-1::gfp | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000471 | Paper_evidence | WBPaper00026706 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "The ALM cells migrate posteriorly during embryogenesis to occupy a range of final positions between the two hypodermal cells, V2 and V3 (Figs. 1 and 3) (Sulston et al., 1983). In cfz-2 mutants, 18% of ALM cells are located anterior to V2 (Fig. 3, Table 1). In addition, even ALM cells that migrate to within the normal range of positions tend to be shifted anteriorly on average (Fig. 3)." | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | 18 | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005406 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | "An ALM was scored as anteriorly misplaced (Ant.) if its nucleus was anterior to the V2 nucleus and posteriorly misplaced (Post.) if posterior to the V3 nucleus." | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000633 | Paper_evidence | WBPaper00026706 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "In males, six Pn.aap neuroblasts divide asymmetrically to produce two daughter cells, CA and CP (Sulston et al., 1980). In wild type, CP neurons extend a single axon towards the posterior and express high levels of serotonin (Loer and Kenyon, 1993).We examined the morphology of the CA and CP neurons and their axons by immunofluorescent histochemistry using anti-serotonin antibodies. We found that in 12% of cfz-2 homozygous mutant males CP neurons produced an anteriorly extending ectopic axon in addition to the normal posteriorly extending axon and 5% had branched axons (Fig. 6, Table 2)." | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Low | 5 | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004903 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004901 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004899 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004897 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004895 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004893 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004891 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004889 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004888 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004887 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0007409 | PATO:0000460 | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | "Axon morphology was examined by indirect immunofluorescence using anti-serotonin antibody (HSN and CP) or two independent GFP-expressing reporter transgenes, ceh-23::gfp and kal-1::gfp (CAN)." | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000952 | Paper_evidence | WBPaper00026706 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Loss of CFZ-2 resulted in disorganization of the anterior ganglion. The kal-1::gfp reporter transgene is expressed in several cells of the anterior ganglia (Bulow et al., 2002). In wild-type animals, the neurons are organized relatively compactly to form the head ganglion (Fig. 7; White et al., 1986). Located halfway between the anterior and posterior bulb of the pharynx is the nerve ring, the major neuropil in the head (White et al., 1986). We noticed that in cfz-2 mutant animals, several kal-1::gfp-expressing cell bodies were shifted anterior 75% of the time, a phenomenon seen in only 13% of the wild-type animals (Fig. 7). Furthermore, the nerve ring was shifted anteriorly in 85% of the animals and was spread more diffusely over a larger area of the head of the animal (Fig. 7)." | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005375 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0061548 | PATO:0000460 | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | kal-1::gfp | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001761 | Paper_evidence | WBPaper00026706 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "More penetrant was a misrouting defect, where approximately 24% of HSN axons inappropriately crossed the ventral midline to extend anteriorly on the contralateral side (Fig. 6, Table 2)." | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | 21 | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006830 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0007409 | PATO:0000460 | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | "Axon morphology was examined by indirect immunofluorescence using anti-serotonin antibody (HSN and CP) or two independent GFP-expressing reporter transgenes, ceh-23::gfp and kal-1::gfp (CAN)." | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0002490 | Paper_evidence | WBPaper00026706 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "In cfz-2 mutants, approximately 8% of HSNs extended a second axon, generally from the posterior side (Table 2). The ectopic axons sometimes appeared to merge with the primary axons, after which they entered the VNC (Fig. 6, Table 2)." | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
"In males, six Pn.aap neuroblasts divide asymmetrically to produce two daughter cells, CA and CP (Sulston et al., 1980). In wild type, CP neurons extend a single axon towards the posterior and express high levels of serotonin (Loer and Kenyon, 1993). We examined the morphology of the CA and CP neurons and their axons by immunofluorescent histochemistry using anti-serotonin antibodies. We found that in 12% of cfz-2 homozygous mutant males CP neurons produced an anteriorly extending ectopic axon in addition to the normal posteriorly extending axon and 5% had branched axons (Fig. 6, Table 2)." | Paper_evidence | WBPaper00026706 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
"Each CAN produces two axons, one that extends anteriorly to the nerve ring and one that extends posteriorly to the tail (Durbin, 1987; White et al., 1986). Both kal-1::gfp and ceh-23::gfp reporter transgenes express GFP in CAN cells and their axons, as well as in other neurons (Bulow et al., 2002; Zallen et al., 1999). We used these two reporter transgenes to independently assess CAN morphology in cfz-2 mutant animals. Most CANs appeared morphologically normal, but occasional axonal defects were detected. On average, 11% of CAN axons produce ectopic branches (Fig. 6, Table 2)." | Paper_evidence | WBPaper00026706 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | 12 | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
11 | Paper_evidence | WBPaper00026706 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Low | 9 | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term (12) | ||||||||
GO_term | GO:0007409 | PATO:0000460 | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | "Axon morphology was examined by indirect immunofluorescence using anti-serotonin antibody (HSN and CP) or two independent GFP-expressing reporter transgenes, ceh-23::gfp and kal-1::gfp (CAN)." | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_not_observed | WBPhenotype:0000469 | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "QL and its descendants migrate posteriorly whereas QR and its descendants migrate anteriorly (Fig. 1; Sulston and Horvitz, 1977). In cfz-2 mutants, the migrations of QR descendants terminated posterior to their normal position 11.8% of the time (Fig. 4, Table 1). QL descendant migration in cfz-2 mutants is indistinguishable from wild type (Table 1)." | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004993 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004086 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | "A QL cell descendant was scored as misplaced anteriorly if its nucleus was anterior to V4.p. Because they occupy positions near each other, the data for SDQL and PVM were combined. The position of PQR, a third QL descendant, was not included because it migrates to a location near other nuclei with similar morphology." | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000594 | Paper_evidence | WBPaper00026706 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 1 | Paper_evidence | WBPaper00026706 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006826 | PATO:0000460 | Paper_evidence | WBPaper00026706 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | "A BDU was scored as defective if its nucleus was posterior to the V1 nucleus." | Paper_evidence | WBPaper00026706 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference | WBPaper00026706 | ||||||||
Method | Substitution_allele |