WormBase Tree Display for Variation: WBVar00054417
expand all nodes | collapse all nodes | view schema
WBVar00054417 | Name | Public_name | ct46 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name (4) | |||||||||
HGVSg | CHROMOSOME_I:g.8295227C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | T01G9 | |||||
Flanking_sequences | aaagtggaagtccagagccacctgcagacc | agatgtttggtccaaaccatcgccaccgtt | |||||||
Mapping_target | T01G9 | ||||||||
Type_of_mutation | Substitution | c | t | Person_evidence | WBPerson399 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00008444 | ||||||||
WBStrain00026463 | |||||||||
Laboratory | BW | ||||||||
Status | Live | ||||||||
Linked_to | WBVar00054422 | ||||||||
WBVar00054427 | |||||||||
WBVar02125078 | |||||||||
Affects | Gene | WBGene00003183 | |||||||
Transcript | T01G9.5a.1 (12) | ||||||||
T01G9.5b.1 (12) | |||||||||
Interactor | WBInteraction000051975 | ||||||||
WBInteraction000051979 | |||||||||
WBInteraction000051980 | |||||||||
WBInteraction000051982 | |||||||||
WBInteraction000519223 | |||||||||
WBInteraction000519224 | |||||||||
WBInteraction000556055 | |||||||||
WBInteraction000556056 | |||||||||
WBInteraction000578852 | |||||||||
Isolation | Mutagen | EMS | |||||||
Genetics | Interpolated_map_position | I | 2.70613 | ||||||
Mapping_data | In_multi_point | 1764 | |||||||
1765 | |||||||||
Description | Phenotype | WBPhenotype:0000050 | Paper_evidence | WBPaper00032438 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00032438 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000351 | Paper_evidence | WBPaper00032438 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Hatching rate reduced at all temperatures, defect slightly better at 15 deg C (13% hatching). | Paper_evidence | WBPaper00032438 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00032438 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000436 | Paper_evidence | WBPaper00004129 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | Mislocalization of MEI-2 to mitotic chromatin and centrosomes in mei-1(ct46gf) mutant embryos. | Paper_evidence | WBPaper00004129 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
Dominant (2) | |||||||||
Variation_effect | Gain_of_function_undetermined_type | Paper_evidence | WBPaper00004129 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
Phenotype_assay | Treatment | Mutant embryos were fixed and stained with anti-MEI-2 antibodies. | Paper_evidence | WBPaper00004129 | |||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0001175 | Paper_evidence | WBPaper00033119 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | 1.4% Him among the surviving mei-1 progeny | Paper_evidence | WBPaper00033119 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00033119 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | tbb-2(sb26) in background | Paper_evidence | WBPaper00033119 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001343 | Paper_evidence | WBPaper00033119 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Meiotic metaphase spindles were significantly shorter than wild type | Paper_evidence | WBPaper00033119 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypermorph_gain_of_function | Paper_evidence | WBPaper00033119 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00033119 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Time-lapse imaging of GFP-tubulin in mei-1(ct46) embryos | Paper_evidence | WBPaper00033119 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Genotype | tbb-2(sb26) in background | Paper_evidence | WBPaper00033119 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001743 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | normal meiosis followed by abnormal mitoses | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Dominant (2) | |||||||||
Variation_effect | Hypermorph_gain_of_function | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference (12) | |||||||||
Method | Substitution_allele |