WormBase Tree Display for Variation: WBVar00000654
expand all nodes | collapse all nodes | view schema
WBVar00000654 | Evidence | Paper_evidence | WBPaper00004880 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | bz29 | ||||||
Other_name | CE21562:p.Trp28Ter | |||||||
Y38A10A.5.1:c.83G>A | ||||||||
HGVSg | CHROMOSOME_V:g.6100427C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | Y38A10A | ||||
Flanking_sequences | acttcaaagaggagttcaacgacgcctcat | ggagaagcgatgggttcaatccaagcacaa | ||||||
Mapping_target | Y38A10A | |||||||
Type_of_mutation | Substitution | g | a | |||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00040781 | |||||||
Laboratory | ZB | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00000802 | ||||||
Transcript | Y38A10A.5.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | |||||||
HGVSc | Y38A10A.5.1:c.83G>A | |||||||
HGVSp | CE21562:p.Trp28Ter | |||||||
cDNA_position | 116 | |||||||
CDS_position | 83 | |||||||
Protein_position | 28 | |||||||
Exon_number | 2/5 | |||||||
Codon_change | tGg/tAg | |||||||
Amino_acid_change | W/* | |||||||
Interactor | WBInteraction000501716 | |||||||
WBInteraction000571514 | ||||||||
WBInteraction000571524 | ||||||||
Genetics | Interpolated_map_position | V | -0.352787 | |||||
Description | Phenotype | WBPhenotype:0002606 | Paper_evidence | WBPaper00041673 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "Likewise, loss of crt-1, cnx-1, itr-1, clp-1, tra-3, asp-3, or asp-4 partially suppressed HBx-induced cell killing (from 50% to 12-32% PLM death; Fig. 2A), indicating that HBx induces cell death in part through the necrotic pathway." | Paper_evidence | WBPaper00041673 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00041673 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | smIs98 [Pmec-3::GFP; Pmec-7::HBx] | Paper_evidence | WBPaper00041673 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Reference | WBPaper00029017 | |||||||
WBPaper00022915 | ||||||||
WBPaper00041673 | ||||||||
Method | Substitution_allele |