WormBase Tree Display for Variation: WBVar00000083
expand all nodes | collapse all nodes | view schema
WBVar00000083 | Evidence | Paper_evidence | WBPaper00002920 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | ad1051 | ||||||
Other_name | CE25076:p.Trp312Ter | |||||||
CE13573:p.Trp133Ter | ||||||||
R11G10.1b.1:c.399G>A | ||||||||
R11G10.1a.1:c.936G>A | ||||||||
HGVSg | CHROMOSOME_V:g.13501125C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | T10G3 | ||||
Flanking_sequences | tagtgtacaactgacattccgtgagagttg | gtcgataagagactcagcttcggagtgaaa | ||||||
Mapping_target | T10G3 | |||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00002920 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain (12) | ||||||||
Laboratory | DA | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00000233 | ||||||
Transcript (2) | ||||||||
Interactor | WBInteraction000500426 | |||||||
WBInteraction000557980 | ||||||||
WBInteraction000557981 | ||||||||
WBInteraction000557983 | ||||||||
Genetics | Interpolated_map_position | V | 5.36893 | |||||
Description | Phenotype (8) | |||||||
Phenotype_not_observed | WBPhenotype:0001182 | Paper_evidence | WBPaper00031915 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | avr-15(ad1051) mutants had wild-type fat content | Paper_evidence | WBPaper00031915 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Treatment | Fat content was visualized by Nile red staining | Paper_evidence | WBPaper00031915 | ||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0001811 | Paper_evidence | WBPaper00031915 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Mutants were susceptible to the fat-reducing effects of exogenously administered serotonin | Paper_evidence | WBPaper00031915 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Treatment | Reduced fat content of 5-HT-treated animals was visualized by Nile red staining and confirmed by thin-layer chromatography (TLC) quantitation of total triglycerides extracted from vehicle- and 5-HT-treated worms and by Sudan black fat staining | Paper_evidence | WBPaper00031915 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Reference (11) | ||||||||
Remark | The correct genotype of the DA1316 strain is avr-14(ad1305) I; avr-15(vu227) glc-1(pk54) V. This strain was incorrectly annotated as avr-14(ad1302) I; avr-15(ad1051) glc-1(pk54) V. when submitted to the CGC. | |||||||
The correct genotype of the DA1370 strain is avr-15(vu227) glc-1(pk54) V. This strain was incorrectly annotated as avr-15(ad1051) glc-1(pk54) V. when submitted to the CGC. | ||||||||
Method | Substitution_allele |