WormBase Tree Display for Variation: WBVar00000063
expand all nodes | collapse all nodes | view schema
WBVar00000063 | Evidence | Paper_evidence | WBPaper00002466 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | ad805 | |||||
Other_name | M01D7.7a.1:c.247-1G>A | ||||||
M01D7.7b.1:c.91-1G>A | |||||||
HGVSg | CHROMOSOME_I:g.1838779G>A | ||||||
Sequence_details | SMap | S_parent | Sequence | M01D7 | |||
Flanking_sequences | gaagccttaaaattcgaactattttttcca | tctatgatacgagcgatggacacattagat | |||||
Mapping_target | M01D7 | ||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00002466 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00005520 | ||||||
Laboratory | DA | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00001196 | |||||
Transcript | M01D7.7b.1 | VEP_consequence | splice_acceptor_variant | ||||
VEP_impact | HIGH | ||||||
HGVSc | M01D7.7b.1:c.91-1G>A | ||||||
Intron_number | 2/8 | ||||||
M01D7.7a.1 | VEP_consequence | splice_acceptor_variant | |||||
VEP_impact | HIGH | ||||||
HGVSc | M01D7.7a.1:c.247-1G>A | ||||||
Intron_number | 3/9 | ||||||
Interactor | WBInteraction000518669 | ||||||
Genetics | Interpolated_map_position | I | -12.5567 | ||||
Mapping_data | In_2_point | 6155 | |||||
In_multi_point | 2661 | ||||||
Description | Phenotype | WBPhenotype:0000006 | Paper_evidence | WBPaper00002305 | |||
Curator_confirmed | WBPerson557 | ||||||
Semi_dominant | Paper_evidence | WBPaper00002305 | |||||
Curator_confirmed | WBPerson557 | ||||||
WBPhenotype:0000022 | Paper_evidence | WBPaper00002305 | |||||
Curator_confirmed | WBPerson557 | ||||||
WBPhenotype:0000153 | Paper_evidence | WBPaper00002305 | |||||
Curator_confirmed | WBPerson557 | ||||||
WBPhenotype:0000205 | Paper_evidence | WBPaper00002305 | |||||
Curator_confirmed | WBPerson557 | ||||||
Semi_dominant | Paper_evidence | WBPaper00002305 | |||||
Curator_confirmed | WBPerson557 | ||||||
WBPhenotype:0000397 | Paper_evidence | WBPaper00032087 | |||||
Curator_confirmed | WBPerson2021 | ||||||
Remark | Animals are essentially unresponsive to harsh physical stimulation | Paper_evidence | WBPaper00032087 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00032087 | ||||
Curator_confirmed | WBPerson2021 | ||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00002305 | |||||
Curator_confirmed | WBPerson557 | ||||||
WBPhenotype:0000644 | Paper_evidence | WBPaper00032087 | |||||
WBPaper00002305 | |||||||
Curator_confirmed | WBPerson2021 | ||||||
WBPerson557 | |||||||
Remark | Animals are nearly paralyzed | Paper_evidence | WBPaper00032087 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Flaccid paralysis. | Paper_evidence | WBPaper00002305 | |||||
Curator_confirmed | WBPerson557 | ||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00032087 | ||||
Curator_confirmed | WBPerson2021 | ||||||
WBPhenotype:0001413 | Paper_evidence | WBPaper00040813 | |||||
Curator_confirmed | WBPerson2706 | ||||||
WBPhenotype:0001645 | Paper_evidence | WBPaper00040284 | |||||
Curator_confirmed | WBPerson2987 | ||||||
Remark | Table 1 | Paper_evidence | WBPaper00040284 | ||||
Curator_confirmed | WBPerson2987 | ||||||
WBPhenotype:0001897 | Paper_evidence | WBPaper00032087 | |||||
Curator_confirmed | WBPerson2021 | ||||||
Remark | Exposure to blue-violet light resulted in a 3.5 fold increase in the locomotion rates of wild-type. However, the locomotion rate of egl-30 mutants upon blue-violet light exposure was not significantly different from the basal rate of wild-type animals. | Paper_evidence | WBPaper00032087 | ||||
Curator_confirmed | WBPerson2021 | ||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00032087 | ||||
Curator_confirmed | WBPerson2021 | ||||||
WBPhenotype:0002378 | Paper_evidence | WBPaper00040813 | |||||
Curator_confirmed | WBPerson2706 | ||||||
Reference | WBPaper00040284 | ||||||
WBPaper00040813 | |||||||
WBPaper00014715 | |||||||
WBPaper00017502 | |||||||
WBPaper00026249 | |||||||
WBPaper00002466 | |||||||
WBPaper00032087 | |||||||
WBPaper00002305 | |||||||
WBPaper00065992 | |||||||
Method | Substitution_allele |