WormBase Tree Display for Variation: WBVar00143389
expand all nodes | collapse all nodes | view schema
WBVar00143389 | Evidence | Person_evidence | WBPerson201 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e669 | |||||||
Other_name (22) | |||||||||
HGVSg | CHROMOSOME_II:g.14657911G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | ZC101 | |||||
Flanking_sequences | atgtttctttcaattaattcaggtccacca | agcacccagtgatcaccccacaaacacaga | |||||||
Mapping_target | ZC101 | ||||||||
Type_of_mutation | Substitution | c | t | Person_evidence | WBPerson201 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004194 | ||||||||
WBStrain00008398 | |||||||||
WBStrain00030680 | |||||||||
WBStrain00034393 | |||||||||
WBStrain00034394 | |||||||||
WBStrain00034411 | |||||||||
WBStrain00034413 | |||||||||
WBStrain00034415 | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Linked_to | WBVar00143390 | ||||||||
Affects | Gene | WBGene00006787 | |||||||
Transcript | ZC101.2l.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZC101.2l.1:c.4225C>T | ||||||||
HGVSp | CE47371:p.Gln1409Ter | ||||||||
cDNA_position | 4315 | ||||||||
CDS_position | 4225 | ||||||||
Protein_position | 1409 | ||||||||
Exon_number | 17/24 | ||||||||
Codon_change | Cag/Tag | ||||||||
Amino_acid_change | Q/* | ||||||||
ZC101.2c.1 | VEP_consequence | intron_variant | |||||||
VEP_impact | MODIFIER | ||||||||
HGVSc | ZC101.2c.1:c.5083+127C>T | ||||||||
Intron_number | 17/23 | ||||||||
ZC101.2f.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZC101.2f.1:c.4813C>T | ||||||||
HGVSp | CE37074:p.Gln1605Ter | ||||||||
cDNA_position | 4904 | ||||||||
CDS_position | 4813 | ||||||||
Protein_position | 1605 | ||||||||
Exon_number | 16/24 | ||||||||
Codon_change | Cag/Tag | ||||||||
Amino_acid_change | Q/* | ||||||||
ZC101.2j.1 | VEP_consequence | intron_variant | |||||||
VEP_impact | MODIFIER | ||||||||
HGVSc | ZC101.2j.1:c.4787-420C>T | ||||||||
Intron_number | 15/22 | ||||||||
ZC101.2o.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZC101.2o.1:c.5092C>T | ||||||||
HGVSp | CE47336:p.Gln1698Ter | ||||||||
cDNA_position | 5092 | ||||||||
CDS_position | 5092 | ||||||||
Protein_position | 1698 | ||||||||
Exon_number | 17/25 | ||||||||
Codon_change | Cag/Tag | ||||||||
Amino_acid_change | Q/* | ||||||||
ZC101.2n.1 | VEP_consequence | intron_variant | |||||||
VEP_impact | MODIFIER | ||||||||
HGVSc | ZC101.2n.1:c.5083+127C>T | ||||||||
Intron_number | 16/23 | ||||||||
ZC101.2d.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZC101.2d.1:c.7192C>T | ||||||||
HGVSp | CE53988:p.Gln2398Ter | ||||||||
cDNA_position | 7352 | ||||||||
CDS_position | 7192 | ||||||||
Protein_position | 2398 | ||||||||
Exon_number | 27/46 | ||||||||
Codon_change | Cag/Tag | ||||||||
Amino_acid_change | Q/* | ||||||||
ZC101.2e.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZC101.2e.1:c.5092C>T | ||||||||
HGVSp | CE18424:p.Gln1698Ter | ||||||||
cDNA_position | 5092 | ||||||||
CDS_position | 5092 | ||||||||
Protein_position | 1698 | ||||||||
Exon_number | 17/35 | ||||||||
Codon_change | Cag/Tag | ||||||||
Amino_acid_change | Q/* | ||||||||
ZC101.2k.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZC101.2k.1:c.4534C>T | ||||||||
HGVSp | CE47284:p.Gln1512Ter | ||||||||
cDNA_position | 4534 | ||||||||
CDS_position | 4534 | ||||||||
Protein_position | 1512 | ||||||||
Exon_number | 14/21 | ||||||||
Codon_change | Cag/Tag | ||||||||
Amino_acid_change | Q/* | ||||||||
ZC101.2m.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZC101.2m.1:c.4795C>T | ||||||||
HGVSp | CE47075:p.Gln1599Ter | ||||||||
cDNA_position | 4795 | ||||||||
CDS_position | 4795 | ||||||||
Protein_position | 1599 | ||||||||
Exon_number | 16/24 | ||||||||
Codon_change | Cag/Tag | ||||||||
Amino_acid_change | Q/* | ||||||||
ZC101.2a.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZC101.2a.1:c.5092C>T | ||||||||
HGVSp | CE15028:p.Gln1698Ter | ||||||||
cDNA_position | 5183 | ||||||||
CDS_position | 5092 | ||||||||
Protein_position | 1698 | ||||||||
Exon_number | 18/26 | ||||||||
Codon_change | Cag/Tag | ||||||||
Amino_acid_change | Q/* | ||||||||
ZC101.2i.1 | VEP_consequence | intron_variant | |||||||
VEP_impact | MODIFIER | ||||||||
HGVSc | ZC101.2i.1:c.4786+564C>T | ||||||||
Intron_number | 16/22 | ||||||||
ZC101.2r.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | ZC101.2r.1:c.7459C>T | ||||||||
HGVSp | CE51929:p.Gln2487Ter | ||||||||
cDNA_position | 7459 | ||||||||
CDS_position | 7459 | ||||||||
Protein_position | 2487 | ||||||||
Exon_number | 27/34 | ||||||||
Codon_change | Cag/Tag | ||||||||
Amino_acid_change | Q/* | ||||||||
Interactor (8) | |||||||||
Genetics | Interpolated_map_position | II | 23.3125 | ||||||
Mapping_data | In_2_point | 771 | |||||||
4502 | |||||||||
In_multi_point | 1552 | ||||||||
Description | Phenotype | WBPhenotype:0000006 | Person_evidence | WBPerson201 | |||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | Adults are partially egg-laying defective. | Person_evidence | WBPerson201 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Penetrance | Complete | Person_evidence | WBPerson201 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Recessive | Person_evidence | WBPerson201 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Person_evidence | WBPerson201 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Person_evidence | WBPerson201 | ||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000164 | Person_evidence | WBPerson201 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | Adults are thin. | Person_evidence | WBPerson201 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Penetrance | Complete | Person_evidence | WBPerson201 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Recessive | Person_evidence | WBPerson201 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Person_evidence | WBPerson201 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Person_evidence | WBPerson201 | ||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000195 | Paper_evidence | WBPaper00005809 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Several previously described class I unc-52 alleles also showed significant increases in the frequency of DTC migration defects of weak unc-5 alleles. These include unc-52(e669), unc-52(e998), and unc-52(e1421) (Table 1)." | Paper_evidence | WBPaper00005809 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
"All class I unc-52 alleles (except e444) strongly enhanced the penetrance of DTC migration defects of a null allele of unc-5 (Table 1)." | Paper_evidence | WBPaper00005809 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00005809 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006865 | PATO:0000460 | Paper_evidence | WBPaper00005809 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00005809 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | unc-5(e152) | Paper_evidence | WBPaper00005809 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
unc-5(e53) | Paper_evidence | WBPaper00005809 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000349 | Person_evidence | WBPerson201 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | Adults are limp. | Person_evidence | WBPerson201 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Penetrance | Complete | Person_evidence | WBPerson201 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Recessive | Person_evidence | WBPerson201 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Person_evidence | WBPerson201 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Person_evidence | WBPerson201 | ||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000553 | Paper_evidence | WBPaper00002086 | |||||||
Curator_confirmed | WBPerson528 | ||||||||
WBPhenotype:0000643 | Person_evidence | WBPerson201 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | Larvae move well until late L4 stage. | Person_evidence | WBPerson201 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
EQ_annotations | Life_stage | WBls:0000038 | PATO:0000460 | Person_evidence | WBPerson201 | ||||
Curator_confirmed | WBPerson48 | ||||||||
WBls:0000041 | PATO:0000460 | Person_evidence | WBPerson201 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000818 | Paper_evidence | WBPaper00002086 | |||||||
Curator_confirmed | WBPerson528 | ||||||||
WBPhenotype:0000868 | Person_evidence | WBPerson201 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | Adults are paralysed (except for head region). | Person_evidence | WBPerson201 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Penetrance | Complete | Person_evidence | WBPerson201 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Recessive | Person_evidence | WBPerson201 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Person_evidence | WBPerson201 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Person_evidence | WBPerson201 | ||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0001645 | Paper_evidence | WBPaper00040284 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 1 | Paper_evidence | WBPaper00040284 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_not_observed | WBPhenotype:0000060 | Paper_evidence | WBPaper00002086 | ||||||
Curator_confirmed | WBPerson528 | ||||||||
Reference (13) | |||||||||
Method | Substitution_allele |