WormBase Tree Display for Variation: WBVar00142949
expand all nodes | collapse all nodes | view schema
WBVar00142949 | Name | Public_name | e75 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name (34) | |||||||||
HGVSg | CHROMOSOME_X:g.5583826C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | F14D12 | |||||
Flanking_sequences | aagagattctatcaaaagattccgtgacagtcg | tgtcgatgctgtcgtttatttccgaatttc | |||||||
Mapping_target | F14D12 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00002482 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004092 | ||||||||
WBStrain00004463 | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003166 | |||||||
Transcript | F14D12.4a.1 (12) | ||||||||
F14D12.4k.1 (12) | |||||||||
F14D12.4i.1 (12) | |||||||||
F14D12.4c.1 (12) | |||||||||
F14D12.4l.1 (12) | |||||||||
F14D12.4h.1 (12) | |||||||||
F14D12.4g.1 (12) | |||||||||
F14D12.4b.1 (12) | |||||||||
F14D12.4e.1 (12) | |||||||||
F14D12.4m.1 (12) | |||||||||
F14D12.4j.1 (12) | |||||||||
F14D12.4q.1 (12) | |||||||||
F14D12.4f.1 (12) | |||||||||
F14D12.4o.1 (12) | |||||||||
F14D12.4n.1 (12) | |||||||||
F14D12.4p.1 (12) | |||||||||
F14D12.4d.1 (12) | |||||||||
Genetics | Interpolated_map_position | X | -4.6377 | ||||||
Mapping_data | In_multi_point | 415 | |||||||
618 | |||||||||
731 | |||||||||
732 | |||||||||
In_pos_neg_data | 940 | ||||||||
1832 | |||||||||
Description | Phenotype | WBPhenotype:0000247 | Paper_evidence | WBPaper00000214 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mutants behave like WT in a Na+ gradient assay; however, mutants are 15% responsive to Na+ in a behavior orientation assay. WT worms are 95% responsive (based on sustained distance from attractant). | Paper_evidence | WBPaper00000214 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000254 | Paper_evidence | WBPaper00000214 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mutants are 5% responsive to Cl- in behavior orientation assay (based on sustained distance from attractant), WT are 70% responsive. | Paper_evidence | WBPaper00000214 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000456 | Paper_evidence | WBPaper00000214 | |||||||
WBPaper00000502 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | weak variable Mec | Paper_evidence | WBPaper00000502 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00000502 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive (3) | |||||||||
WBPhenotype:0001213 | Paper_evidence | WBPaper00000214 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mutants are lethargic in bacteria but active on a bare plate. | Paper_evidence | WBPaper00000214 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001438 | Paper_evidence | WBPaper00001786 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Defective in chemotaxis to volatile odorants including benzaldehyde, 2-butanone and isoamyl alcohol (Data not shown). | Paper_evidence | WBPaper00001786 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00001786 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_not_observed | WBPhenotype:0000067 | Paper_evidence | WBPaper00003582 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | mutants showed a normal feeding inhibition response when exposed to either cadmium or captan | Paper_evidence | WBPaper00003582 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000412 | Paper_evidence | WBPaper00003408 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0000637 | Paper_evidence | WBPaper00000214 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000663 | Paper_evidence | WBPaper00003408 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0001221 | Paper_evidence | WBPaper00003408 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0004004 | Paper_evidence | WBPaper00000214 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Males exhibit continued tactile sexual behavior. | Paper_evidence | WBPaper00000214 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference (15) | |||||||||
Method | Substitution_allele |