WormBase Tree Display for Variation: WBVar00241329
expand all nodes | collapse all nodes | view schema
WBVar00241329 | Evidence | Paper_evidence | WBPaper00005804 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | r367 | |||||||
Other_name | C47E8.7.1:c.254C>T | ||||||||
CE05443:p.Thr85Ile | |||||||||
HGVSg | CHROMOSOME_V:g.14694964G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | C47E8 | |||||
Flanking_sequences | ctcttgaccagaatggaattacagctgaaa | acaattggagttcacaccaatgcataaaga | |||||||
Mapping_target | C47E8 | ||||||||
Type_of_mutation | Substitution | c | t | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00005871 | ||||||||
WBStrain00005872 | |||||||||
WBStrain00005875 | |||||||||
WBStrain00005876 | |||||||||
WBStrain00005877 | |||||||||
WBStrain00005878 | |||||||||
WBStrain00005879 | |||||||||
WBStrain00005880 | |||||||||
WBStrain00005881 | |||||||||
WBStrain00005886 | |||||||||
WBStrain00035507 | |||||||||
WBStrain00035508 | |||||||||
Laboratory | TR | ||||||||
Status | Live | ||||||||
Linked_to | WBVar00241330 | ||||||||
WBVar00241331 | |||||||||
WBVar00241332 | |||||||||
WBVar00241333 | |||||||||
Affects | Gene | WBGene00006836 | |||||||
Transcript | C47E8.7.1 (12) | ||||||||
Interactor (9) | |||||||||
Genetics | Interpolated_map_position | V | 6.70023 | ||||||
Description | Phenotype | WBPhenotype:0000164 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Adults thin except for head region. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000181 | Paper_evidence | WBPaper00031671 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | In unc-112 mutants, 9% of the NSM sub-ventral processes are short | Paper_evidence | WBPaper00031671 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003666 | PATO:0000460 | Paper_evidence | WBPaper00031671 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | zdIs13 [ tph-1p::GFP] | Paper_evidence | WBPaper00031671 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000640 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00040652 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Although the unc-112ts mutants are not fully normal in movement rate even when grown at the ''permissive'' 16 degC, they show a pronounced loss of mobility within 24 h after ashift to 25 degC. | Paper_evidence | WBPaper00040652 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00040652 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00040652 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000644 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Adults paralysed. Easy to score (ES3) in adults. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000926 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Disorganized body wall muscle, frayed myofilament lattice; young larvae nearly wild type (phenotypes very similar to unc-52). | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001401 | Paper_evidence | WBPaper00040652 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Severe mitochondrial fragmentation occurs in unc-112ts mutants. | Paper_evidence | WBPaper00040652 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00040652 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00040652 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001645 | Paper_evidence | WBPaper00040652 | |||||||
WBPaper00040284 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2987 | |||||||||
Remark | Acute temperature shift of fully developed adult animals results in protein degradation in mutants but not in wild-type animals. Whole body protein, as assessed in triplicate 30 worm samples by coomassie staining and quantified in ImageJ, was reduced in unc-112ts mutants, but not wild-type animals, 48 hours post temperature shift. | The same temperature shift experiments in the presence of the protein synthesis inhibitor cycloheximide (CHx) showed that degradation was occurring by activation of pre-existing protease(s). | Degradation was not prevented by treatment with levamisole (Lev), MG132 (ZLLL), SB201290, or N6,N6-dimethyladenosine. | Acute treatment with calpain inhibitors did suppress protein degradation. | Paper_evidence | WBPaper00040652 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Table 1 | Paper_evidence | WBPaper00040284 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Affected_by | Molecule | WBMol:00004352 | Paper_evidence | WBPaper00040652 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBMol:00004019 | Paper_evidence | WBPaper00040652 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBMol:00005301 | Paper_evidence | WBPaper00040652 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBMol:00005300 | Paper_evidence | WBPaper00040652 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBMol:00005302 | Paper_evidence | WBPaper00040652 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBMol:00005303 | Paper_evidence | WBPaper00040652 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00040652 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001889 | Paper_evidence | WBPaper00040652 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Arrayed sarcomeres were disrupted in unc-112ts mutants. Also actin filaments are torn in fixed unc-112ts mutant animals stained with RITC-phalloidin at 24 hrs post temperature shift. No degradation of either myosin heavy chain or actin was observed in western blots of unc-112ts mutant animals (not shown). | Paper_evidence | WBPaper00040652 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00040652 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00040652 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002142 | Paper_evidence | WBPaper00046120 | |||||||
Curator_confirmed | WBPerson1754 | ||||||||
Remark | Figure 1 B; "MRAP and movement forces were measured in animals possessing either of 2 integrin-adhesome component mutations: unc-52/perlecan or unc-112/kindlin. These mutants were selected because they represent collapse at the level of the extracellularmatrix interface (unc-52) and intracellular interface (unc-112). Both mutants display reduced rates of maximal mitochondrial ATP production with glutamate + succinate as a substrate (667 +/- 428, 294 +/- 212, and 1278 +/- 634 nmol ATP min21 at 25C /mmol acetyl-CoA21 min21 at 30C at 30C for unc-52, unc-112, and wild-type animals, respectively; P , 0.001; Fig. 1B). Maximal ATP production was also significantly reduced in both mutants when glutamate + malate and palmitoyl-l-carnitine + malate were used as mitochondrial substrates (P , 0.05). Only unc-112 mutants displayed lowered maximal ATP production when pyruvate + malate and succinate were used as substrates (P , 0.05)." | Paper_evidence | WBPaper00046120 | ||||||
Curator_confirmed | WBPerson1754 | ||||||||
Phenotype_assay | Genotype | ccIs55(unc-54::lacZ) | Paper_evidence | WBPaper00046120 | |||||
Curator_confirmed | WBPerson1754 | ||||||||
Reference | WBPaper00040284 | ||||||||
WBPaper00040652 | |||||||||
WBPaper00031671 | |||||||||
WBPaper00023580 | |||||||||
WBPaper00046120 | |||||||||
Method | Substitution_allele |