WormBase Tree Display for Variation: WBVar00144297
expand all nodes | collapse all nodes | view schema
WBVar00144297 | Name | Public_name | e1778 | ||||
---|---|---|---|---|---|---|---|
Other_name | T19E10.1a.2:c.334_623del | ||||||
CE18264:p.Arg112TrpfsTer4 | |||||||
T19E10.1a.1:c.334_623del | |||||||
T19E10.1b.1:c.334_623del | |||||||
CE01671:p.Arg112TrpfsTer4 | |||||||
HGVSg | CHROMOSOME_II:g.10782318_10782823del | ||||||
Sequence_details | SMap | S_parent | Sequence | T19E10 | |||
Flanking_sequences | aagaataggctgagtccttcaaatacgcca | ggcagctcgcaacgtcatcaaatcctgcaa | |||||
Mapping_target | T19E10 | ||||||
Type_of_mutation | Deletion | ||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00004473 | ||||||
WBStrain00004792 | |||||||
Laboratory | CB | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00002297 | |||||
Transcript | T19E10.1b.1 (11) | ||||||
T19E10.1a.2 (11) | |||||||
T19E10.1a.1 (11) | |||||||
Genetics | Interpolated_map_position | II | 3.1257 | ||||
Mapping_data | In_2_point | 706 | |||||
In_multi_point | 591 | ||||||
In_pos_neg_data | 7149 | ||||||
Description | Phenotype | WBPhenotype:0000643 | Person_evidence | WBPerson261 | |||
Curator_confirmed | WBPerson712 | ||||||
Remark | uncoordinated polynucleate oocytes, abnormal positioning of germ linenuclei | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000668 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | polynucleate oocytes, abnormal positioning of germ linenuclei | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0000688 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | sterile | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
WBPhenotype:0001952 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||
Remark | abnormal positioning of germ line nuclei | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||
Reference | WBPaper00012484 | ||||||
WBPaper00023163 | |||||||
Remark | e1771 appears in legend of fig 1A in WBPaper00026774 but the allele actually described in the figure is e1778 | Paper_evidence | WBPaper00026774 | ||||
Curator_confirmed | WBPerson2970 | ||||||
Method | Deletion_allele |