WormBase Tree Display for Variation: WBVar00144303
expand all nodes | collapse all nodes | view schema
WBVar00144303 | Evidence | Paper_evidence | WBPaper00027140 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e1787 | |||||||
Other_name (4) | |||||||||
HGVSg | CHROMOSOME_I:g.949947G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y34D9B | |||||
Flanking_sequences | ttgagccattcaaaaagaattttgaagttc | aaatctcgtgcaccgactacacccatcacc | |||||||
Mapping_target | Y34D9B | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00027140 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00004471 | ||||||||
WBStrain00008499 | |||||||||
WBStrain00008500 | |||||||||
WBStrain00008502 | |||||||||
WBStrain00008506 | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003238 | |||||||
Transcript | Y34D9B.1a.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y34D9B.1a.1:c.829C>T | ||||||||
HGVSp | CE24203:p.Gln277Ter | ||||||||
cDNA_position | 883 | ||||||||
CDS_position | 829 | ||||||||
Protein_position | 277 | ||||||||
Exon_number | 8/11 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
Y34D9B.1b.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y34D9B.1b.1:c.841C>T | ||||||||
HGVSp | CE24204:p.Gln281Ter | ||||||||
cDNA_position | 978 | ||||||||
CDS_position | 841 | ||||||||
Protein_position | 281 | ||||||||
Exon_number | 8/11 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
Interactor (14) | |||||||||
Genetics | Interpolated_map_position | I | -17.492 | ||||||
Mapping_data | In_multi_point | 1241 | |||||||
3434 | |||||||||
3435 | |||||||||
Description | Phenotype (15) | ||||||||
Phenotype_not_observed | WBPhenotype:0000070 | Paper_evidence | WBPaper00002582 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No defects were reported in the morphology of the male tail hook and rays 1-6. | Paper_evidence | WBPaper00002582 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | High | Paper_evidence | WBPaper00002582 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00002582 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00002582 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000104 | Paper_evidence | WBPaper00044679 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | The mig-1(e1787) mutation does not affect anteroposterior polarity in the AVG interneuron | Paper_evidence | WBPaper00044679 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003850 | PATO:0000460 | Paper_evidence | WBPaper00044679 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000232 | Paper_evidence | WBPaper00024898 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 1 | Paper_evidence | WBPaper00024898 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006827 | PATO:0000460 | Paper_evidence | WBPaper00024898 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00024898 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00024898 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | From Table 1 legend: "A CAN was scored as defective if its nucleus was anterior to the V3 nucleus." | Paper_evidence | WBPaper00024898 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000384 | Paper_evidence | WBPaper00035405 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | No axon guidance defects in SIA/SIB/SMD neurons | Paper_evidence | WBPaper00035405 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000469 | Paper_evidence | WBPaper00024898 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 1 | Paper_evidence | WBPaper00024898 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004991 | PATO:0000460 | Paper_evidence | WBPaper00024898 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0003832 | PATO:0000460 | Paper_evidence | WBPaper00024898 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00024898 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00024898 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | From Table 1 legend: "Because they occupy positions near each other, the data for SDQR and AVM were combined and are presented in the QR column. SDQR and AVM were scored as defective if their nuclei were posterior to the V2.a nucleus. The position of AQR, a third QR descendant, was not included because it migrates to a location near other nuclei with similar morphology." | Paper_evidence | WBPaper00024898 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000471 | Paper_evidence | WBPaper00024898 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 1 | Paper_evidence | WBPaper00024898 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005406 | PATO:0000460 | Paper_evidence | WBPaper00024898 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00024898 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00024898 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | From the Table 1 legend: "An ALM was scored as defective if its nucleus was anterior to the V2 nucleus." | Paper_evidence | WBPaper00024898 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000594 | Paper_evidence | WBPaper00024898 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 1 | Paper_evidence | WBPaper00024898 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006826 | PATO:0000460 | Paper_evidence | WBPaper00024898 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00024898 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00024898 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | From Table 1 legend: "Because BDUs sometimes were misplaced anteriorly and at other times were misplaced posteriorly, we present the data for both phenotypes. A BDU was scored as misplaced anteriorly if its nucleus was anterior to its normal position immediately anterior to V1 and misplaced posteriorly if its nucleus was posterior to the V1 nucleus." | Paper_evidence | WBPaper00024898 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000852 | Paper_evidence | WBPaper00002582 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Coelomocytes were produced. | Paper_evidence | WBPaper00002582 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | High | Paper_evidence | WBPaper00002582 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00002582 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00002582 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000883 | Paper_evidence | WBPaper00035405 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Nerve ring development is normal | Paper_evidence | WBPaper00035405 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001224 | Paper_evidence | WBPaper00060654 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | There are six Wnt receptors encoded in the C. elegans genome: four Frizzled receptors (LIN-17, CFZ-2, MIG-1 and MOM-5,), one Ror receptor (CAM-1) and one Ryk receptor (LIN-18) (Sawa and Korswagen, 2013). We analyzed the effect of loss-of-function mutations for each receptor and found that loss of cam-1, but not the other receptors, caused defective SMDD axonal development (Figure 1D). | Paper_evidence | WBPaper00060654 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004972 | PATO:0000460 | Paper_evidence | WBPaper00060654 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0004971 | PATO:0000460 | Paper_evidence | WBPaper00060654 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001235 | Paper_evidence | WBPaper00004436 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Animals exhibited wild type V5 cell division polarity (Table 2) | Paper_evidence | WBPaper00004436 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004890 | PATO:0000460 | Paper_evidence | WBPaper00004436 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004876 | PATO:0000460 | Paper_evidence | WBPaper00004436 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004250 | PATO:0000460 | Paper_evidence | WBPaper00004436 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0007446 | PATO:0000460 | Paper_evidence | WBPaper00004436 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0004246 | PATO:0000460 | Paper_evidence | WBPaper00004436 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBbt:0007463 | PATO:0000460 | Paper_evidence | WBPaper00004436 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00004436 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Temperature | 25 | Paper_evidence | WBPaper00004436 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001652 | Paper_evidence | WBPaper00032446 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference (16) | |||||||||
Method | Substitution_allele |