WormBase Tree Display for Variation: WBVar00088387
expand all nodes | collapse all nodes | view schema
WBVar00088387 | Evidence | Paper_evidence | WBPaper00002930 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | ky10 | |||||||
Other_name | B0212.5.1:c.517C>T | ||||||||
CE20445:p.Gln173Ter | |||||||||
HGVSg | CHROMOSOME_IV:g.3556045G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | B0212 | |||||
Flanking_sequences | GCGGCCTGAAACATTGTGTTATCTTTAGGC | AATCAGCCCTCCACCTAGCCATTGTACACG | |||||||
Mapping_target | B0212 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00002930 | ||||
Person_evidence | WBPerson40923 | ||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00005214 | ||||||||
WBStrain00007483 | |||||||||
WBStrain00052609 | |||||||||
Laboratory | CX | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003889 | |||||||
Transcript | B0212.5.1 | VEP_consequence | stop_gained,splice_region_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | B0212.5.1:c.517C>T | ||||||||
HGVSp | CE20445:p.Gln173Ter | ||||||||
cDNA_position | 517 | ||||||||
CDS_position | 517 | ||||||||
Protein_position | 173 | ||||||||
Exon_number | 5/15 | ||||||||
Codon_change | Caa/Taa | ||||||||
Amino_acid_change | Q/* | ||||||||
Interactor (17) | |||||||||
Genetics | Interpolated_map_position | IV | -3.15548 | ||||||
Description | Phenotype (34) | ||||||||
Phenotype_not_observed | WBPhenotype:0000302 | Paper_evidence | WBPaper00002930 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00002930 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null (2) | ||||||||
Phenotype_assay | Treatment | 1:200 dilution of benzaldehyde | Paper_evidence | WBPaper00002930 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000304 | Paper_evidence | WBPaper00002930 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00002930 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null (2) | ||||||||
Phenotype_assay | Treatment | 1:100 dilution of isoamyl alcohol | Paper_evidence | WBPaper00002930 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000306 | Paper_evidence | WBPaper00002930 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | AWA specific expression of odr-7::GFP is unaltered in osm-9 mutants | Paper_evidence | WBPaper00002930 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00002930 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null (2) | ||||||||
Phenotype_assay | Genotype | kyIs38 | Paper_evidence | WBPaper00002930 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000398 | Paper_evidence | WBPaper00002930 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants respond to stroking to the body with a hair | Paper_evidence | WBPaper00002930 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00002930 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null (2) | ||||||||
WBPhenotype:0000481 | Paper_evidence | WBPaper00065019 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | osm-9 mutants (osm-9: solvent vs Argentine ant extract, t(40) = 1.434, p = 0.239). Within groups exposed to Argentine ant compounds, the response of osm-9 mutants was significantly different from both PD1074 (t(40) = 2.990, p = 0.010) and tax-4 mutants (t(40) = 3.189, p = 0.006). | Paper_evidence | WBPaper00065019 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Extracts of the Velvety tree ant showed a different pattern of behavioral response, in which tax-4 mutants were repelled by the extracts (tax-4: solvent vs Velvety tree ant extract, t(40) = 5.645, p < 0.001), but osm-9 mutants (osm-9: solvent vs Velvety tree ant extract, t(40) = 0.018, p = 0.985) and the wild type (PD1074: solvent vs Velvety tree ant extract, t(40) = 1.096, p = 0.373) were not. | Paper_evidence | WBPaper00065019 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00008002 | Paper_evidence | WBPaper00065019 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBMol:00008001 | Paper_evidence | WBPaper00065019 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000630 | Paper_evidence | WBPaper00035961 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003904 | Paper_evidence | WBPaper00035961 | |||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005665 | PATO:0000460 | Paper_evidence | WBPaper00035961 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000905 | Paper_evidence | WBPaper00002930 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | The morphology of AWA and ASH neurons is normal | Paper_evidence | WBPaper00002930 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00002930 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null (2) | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005670 | PATO:0000460 | Paper_evidence | WBPaper00002930 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0005665 | PATO:0000460 | Paper_evidence | WBPaper00002930 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001084 | Paper_evidence | WBPaper00005150 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Phenotype_assay | Treatment | Chemotaxis assay for a 10 minute timepoint. | Paper_evidence | WBPaper00005150 | |||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0001085 | Paper_evidence | WBPaper00002930 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00002930 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null (2) | ||||||||
Phenotype_assay | Treatment | 1:1000 dilution of butanone | Paper_evidence | WBPaper00002930 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001086 | Paper_evidence | WBPaper00002930 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00002930 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Null (2) | ||||||||
Phenotype_assay | Treatment | 1:1000 dilution of trimethylthiazole | Paper_evidence | WBPaper00002930 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001435 | Paper_evidence | WBPaper00005150 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Phenotype_assay | Treatment | Chemotaxis assay for a 10 minute timepoint. | Paper_evidence | WBPaper00005150 | |||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0001442 | Paper_evidence | WBPaper00005150 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Phenotype_assay | Treatment | Chemotaxis assay for a 10 minute timepoint. | Paper_evidence | WBPaper00005150 | |||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0001454 | Paper_evidence | WBPaper00059946 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Individual loss of neither OSM-9 nor OCR-2 function affected response to 10mM quinine (Figure 1A), similar to our previous report (Ezak et al. 2010). Further, osm-9 and ocr-2 single mutants responded similarly to wild-type animals across the range of quinine concentrations tested (10mM - 1mM, Figure 1A). | Paper_evidence | WBPaper00059946 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003904 | Paper_evidence | WBPaper00059946 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001469 | Paper_evidence | WBPaper00032215 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibited attraction to butanone similar to wild-type animals. | Paper_evidence | WBPaper00032215 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00005086 | Paper_evidence | WBPaper00032215 | |||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005665 | PATO:0000460 | Paper_evidence | WBPaper00032215 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005661 | PATO:0000460 | Paper_evidence | WBPaper00032215 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001484 | Paper_evidence | WBPaper00005150 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Phenotype_assay | Treatment | Chemotaxis assay for a 10 minute timepoint. | Paper_evidence | WBPaper00005150 | |||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0001741 | Paper_evidence | WBPaper00032000 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | <10% males displayed spontaneous spicule-muscle seizures in the presence or absence of food. | Paper_evidence | WBPaper00032000 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005826 | PATO:0000460 | Paper_evidence | WBPaper00032000 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBbt:0005312 | PATO:0000460 | Paper_evidence | WBPaper00032000 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00032000 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | To effect food deprivation animals were moved to plates with no food (E. coli) or fed inedible bacteria (aztreonam-treated E. coli). | Paper_evidence | WBPaper00032000 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001765 | Paper_evidence | WBPaper00031935 | |||||||
WBPaper00031936 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2021 | |||||||||
Remark | Carbon dioxide avoidance (Cdad) was not defective in the presence or absence of food. | Paper_evidence | WBPaper00031935 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Mutants respond normally to CO2 | Paper_evidence | WBPaper00031936 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00031936 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Strains were maintained at 22C. Animals were exposed to a 5% to 0% CO2 gradient. | Paper_evidence | WBPaper00031935 | |||||
Curator_confirmed | WBPerson712 | ||||||||
10% CO2 | Paper_evidence | WBPaper00031936 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001780 | Paper_evidence | WBPaper00029060 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants show normal butanone enhancement | Paper_evidence | WBPaper00029060 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00029060 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | Preexposure to 1:10 dilution of butanone and food. Animals were then subjected to odorant chemotaxis assays and/or selection assays | Paper_evidence | WBPaper00029060 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001939 | Paper_evidence | WBPaper00035961 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003731 | Paper_evidence | WBPaper00035961 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBMol:00003904 | Paper_evidence | WBPaper00035961 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBMol:00003565 | Paper_evidence | WBPaper00035961 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBMol:00001530 | Paper_evidence | WBPaper00035961 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBMol:00005022 | Paper_evidence | WBPaper00035961 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference (25) | |||||||||
Remark | Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00003889 Ochre_UAA Q(173) to stop | Paper_evidence | WBPaper00002930 | ||||||
Method | Substitution_allele |