WormBase Tree Display for Variation: WBVar00143205
expand all nodes | collapse all nodes | view schema
WBVar00143205 | Name | Public_name | e428 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | CE26205:p.Gln394Ter | ||||||||
Y59A8B.1a.1:c.1180C>T | |||||||||
HGVSg | CHROMOSOME_V:g.17945749G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y59A8B | |||||
Flanking_sequences | acgtcatccacggactcactggagcatatg | agaggaagagaaagaagcaacaggagactg | |||||||
Mapping_target | Y59A8B | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00006355 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (18) | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001080 | |||||||
Transcript | Y59A8B.1a.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y59A8B.1a.1:c.1180C>T | ||||||||
HGVSp | CE26205:p.Gln394Ter | ||||||||
cDNA_position | 1345 | ||||||||
CDS_position | 1180 | ||||||||
Protein_position | 394 | ||||||||
Exon_number | 7/13 | ||||||||
Codon_change | Cag/Tag | ||||||||
Amino_acid_change | Q/* | ||||||||
Interactor | WBInteraction000052180 | ||||||||
WBInteraction000052432 | |||||||||
WBInteraction000501500 | |||||||||
Genetics (2) | |||||||||
Description | Phenotype | WBPhenotype:0000006 | Paper_evidence | WBPaper00001077 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Slightly Egl. | Paper_evidence | WBPaper00001077 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000062 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | lethal to 2A;3X | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000066 | Paper_evidence | WBPaper00001077 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 85% XX viable. | Paper_evidence | WBPaper00001077 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000135 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Some X chromosome transcript levels elevated, in both XX and XO. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000136 | Paper_evidence | WBPaper00001011 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | mRNA levels of lin-14 are elevated ~1.9 fold | Paper_evidence | WBPaper00001011 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000024 | PATO:0000460 | Paper_evidence | WBPaper00001011 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | RNA preparations were made from staged L1 animals and mRNA levels were normalized against act-1 mRNA levels. | Paper_evidence | WBPaper00001011 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000583 | Paper_evidence | WBPaper00001077 | |||||||
WBPaper00000666 | |||||||||
WBPaper00001011 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | XX animals are Dumpy; XO animals are not Dumpy. | Paper_evidence | WBPaper00000666 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
XX animals are dumpy. | Paper_evidence | WBPaper00001011 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
weak dumpy (XX); non-dumpy (XO), easy to score as adult, not easy to score as L1. | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00000666 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | her-1(e1520) him-5 lin-14(n179) | Paper_evidence | WBPaper00001011 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000717 | Paper_evidence | WBPaper00048953 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "To test if the expression changes seen in dpy-21(e428) and set-4(n4600) mutants are due to transcription, we performed AMA-1 (RNA Pol II large subunit) ChIP-seq analysis. Average RNA Pol II enrichment across the transcription start and end sites showed a 3' accumulation that was also noted in the GRO-seq analysis for C. elegans genes (Fig 5G) [43]. RNA Pol II on the X chromosome promoters increased relative to autosomes in dpy-21(e428) mutant (Fig 5G). In the set-4(n4600) mutant (Fig 5G), there was a subtle shift in RNA Pol II levels between the X and autosomes, suggesting that the effect of set-4 is also at the level of transcription. These results do not exclude post-transcriptional effects contributing to increased X expression in the dpy-21(e428) and set-4(n4600) mutants, but do suggest that dpy21 and set-4 act at the level of transcription." | Paper_evidence | WBPaper00048953 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000718 | Paper_evidence | WBPaper00001011 | |||||||
WBPaper00048953 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2987 | |||||||||
Remark | As determined by the penetrance of the lin-14(n179) mutant phenotype, based on the [# mutant seam cell nuclei (undivided seam cell nuclei + nuclei that generated precocious alae)/ total # seam cell nuclei] animals after the L3 molt. | Paper_evidence | WBPaper00001011 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
"In mixed embryos and L3, dpy-21(e428) mutation also caused X chromosome derepression (Fig 3F). In early embryos, dpy-21(e428) had a relatively less X-specific effect compared to dpy-27(y56). In dpy-21(e428) early embryos, 72% of X and 58% of autosomal genes were significantly upregulated." | Paper_evidence | WBPaper00048953 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
"The effect of dpy-21(e428) on X chromosome expression was more specific in the later stage worms. Clustering and heatmap analysis of gene expression changes showed that dpy-21 (e428) caused both increased and decreased expression from the X chromosomes in early embryos, whereas majority of the X chromosomal genes were derepressed in comma stage embryos and L3s (S4C Fig)." | Paper_evidence | WBPaper00048953 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
"H4K20me1 reduction due to set-1 or dpy-21 null mutation led to a significant increase in X chromosome expression compared to autosomes in L3 larvae (Fig 5C). We observed a small but significant increase in X expression compared to autosomes in the set-4(n4600) mutant L3 (Fig 5C) and mixed stage embryos (Fig 5D). Expression of previously defined dosage compensated genes [11,23,42] were increased in dpy-21(e428), set-1(tm1821), but not as much in set-4 (n4600) mutant (Fig 5E). To test if a subset of X chromosomal genes were responsible for the effect seen in the set-4(n4600) mutant (Fig 5C), we plotted the distribution of expression ratios on the X and autosomes (Fig 5F). This indicated a slight shift between X and autosomes, suggesting that set-4(n4600) has a subtle effect across all genes, rather than a large effect on a subset of X chromosomal genes." | Paper_evidence | WBPaper00048953 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
"To understand the role of dpy-21 in the DCC, we compared gene expression changes in dpy-27 RNAi, dpy-21(e428), set-1(tm1821) and set-4(n4600) mutant L3 larvae by clustering differential expression ratios on the X chromosome and autosomes (Fig 6A). We note that while the effect of dpy-27 RNAi and dpy-21(e428) were generally similar on the X, genes in several clusters were affected differently between dpy-27 RNAi and dpy-21 (e428). We performed gene ontology (GO) analyses comparing enriched functions in each cluster compared to the whole genome (Fig 6B). Interestingly, the effect of dpy-27 RNAi and dpy-21(e428) on clusters enriched for cuticle genes were opposite, yet both mutations result in a dumpy phenotype." | Paper_evidence | WBPaper00048953 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Treatment | Nomarski optics were used to follow the fates of the midbody seam cell nuclei of L3 animals raised at 24C. | Paper_evidence | WBPaper00001011 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 24 | Paper_evidence | WBPaper00001011 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | lin-14(n179) | Paper_evidence | WBPaper00001011 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001348 | Paper_evidence | WBPaper00046016 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | Decreased X chromosome compaction leading to enlarged X chromosomes. | Paper_evidence | WBPaper00046016 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0001361 | Paper_evidence | WBPaper00046016 | |||||||
Curator_confirmed | WBPerson557 | ||||||||
Remark | Decreased X chromosome compaction leading to enlarged X chromosomes. | Paper_evidence | WBPaper00046016 | ||||||
Curator_confirmed | WBPerson557 | ||||||||
WBPhenotype:0001581 | Paper_evidence | WBPaper00001011 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals have 31%(n=40) mutant seam cell nuclei, similar to XXX lin-14 animals (26% n=25) and less mutant than XX lin-14 animals (77% n=40). | Paper_evidence | WBPaper00001011 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006913 | PATO:0000460 | Paper_evidence | WBPaper00001011 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000035 | PATO:0000460 | Paper_evidence | WBPaper00001011 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Nomarski optics were used to follow the fates of the midbody seam cell nuclei of L3 animals raised at 24C. | Paper_evidence | WBPaper00001011 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 24 | Paper_evidence | WBPaper00001011 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | lin-14(n179) | Paper_evidence | WBPaper00001011 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001582 | Paper_evidence | WBPaper00001011 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | XO lin-14(n179) males display significantly more lin-14 seam cell defects than lin-14 animals alone but similar to levels observed for lin-14/Df animals. Similar results were observed for e428/e459 (data not shown). | Paper_evidence | WBPaper00001011 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00001011 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 20 | Paper_evidence | WBPaper00001011 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | lin-14(n179) or her-1(e1520) him-5 lin-14(n179) | Paper_evidence | WBPaper00001011 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001583 | Paper_evidence | WBPaper00001011 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | XXX and XXXX progeny are lethal. | Paper_evidence | WBPaper00001011 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002078 | Paper_evidence | WBPaper00048953 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "We analyzed genome-wide expression changes that occur in dpy-21(e428), set-1(tm1821) and set-4(n4600) null mutants [18,19]. Set-1 null mutant is maternal effect sterile, and RNAi knockdown of set-1 leads to germline deficient adults, thus we could not isolate embryos. Therefore, we collected set-1(tm1821) homozygous and heterozygous L3 larvae (see Material and Methods). Western blot analysis in whole-larval extracts showed expected changes in H4K20me1 (Fig 5B) [18,19]. H4K20me1 reduced in dpy-21(e428), increased in set-4(n4600), and was eliminated in set-1(tm1821)." | Paper_evidence | WBPaper00048953 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_not_observed | WBPhenotype:0000065 | Paper_evidence | WBPaper00001077 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000520 | Paper_evidence | WBPaper00000666 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | XO males are morphologically indistinguishable from wild type males. | Paper_evidence | WBPaper00000666 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00000666 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00000666 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000648 | Paper_evidence | WBPaper00000666 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | XO males are not mating deficient relative to wild type males in fertility measurements. | Paper_evidence | WBPaper00000666 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00000666 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00000666 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Reference (13) | |||||||||
Remark | The molecular changes given above for this allele were previously attributed to allele y428, owing to a published typo. | Person_evidence | WBPerson421 | ||||||
Method | Substitution_allele |