WormBase Tree Display for Variation: WBVar00143000
expand all nodes | collapse all nodes | view schema
WBVar00143000 | Evidence | Paper_evidence | WBPaper00003350 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name (3) | |||||||||
Sequence_details | SMap | S_parent | Sequence | Y37D8A | |||||
Flanking_sequences | acaatgatgttttcaagctttggttgatgt | gaagagcaagggaatggagggatatcgtca | |||||||
Mapping_target | Y37D8A | ||||||||
Type_of_mutation | Substitution | G | A | Paper_evidence | WBPaper00003350 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin (4) | |||||||||
Affects | Gene | WBGene00006762 | |||||||
Transcript | Y37D8A.23c.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y37D8A.23c.1:c.923G>A | ||||||||
HGVSp | CE32012:p.Trp308Ter | ||||||||
cDNA_position | 923 | ||||||||
CDS_position | 923 | ||||||||
Protein_position | 308 | ||||||||
Exon_number | 4/6 | ||||||||
Codon_change | tGg/tAg | ||||||||
Amino_acid_change | W/* | ||||||||
Y37D8A.23b.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y37D8A.23b.1:c.1148G>A | ||||||||
HGVSp | CE31832:p.Trp383Ter | ||||||||
cDNA_position | 1148 | ||||||||
CDS_position | 1148 | ||||||||
Protein_position | 383 | ||||||||
Exon_number | 6/9 | ||||||||
Codon_change | tGg/tAg | ||||||||
Amino_acid_change | W/* | ||||||||
Y37D8A.23a.1 | VEP_consequence | stop_gained | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | Y37D8A.23a.1:c.1148G>A | ||||||||
HGVSp | CE20226:p.Trp383Ter | ||||||||
cDNA_position | 1158 | ||||||||
CDS_position | 1148 | ||||||||
Protein_position | 383 | ||||||||
Exon_number | 7/10 | ||||||||
Codon_change | tGg/tAg | ||||||||
Amino_acid_change | W/* | ||||||||
Interactor | WBInteraction000001428 | ||||||||
WBInteraction000517365 | |||||||||
WBInteraction000517573 | |||||||||
WBInteraction000555296 | |||||||||
WBInteraction000558065 | |||||||||
WBInteraction000558066 | |||||||||
Genetics | Interpolated_map_position | III | 20.6631 | ||||||
Mapping_data | In_2_point | 57 | |||||||
68 | |||||||||
78 | |||||||||
6019 | |||||||||
6109 | |||||||||
7009 | |||||||||
7010 | |||||||||
In_multi_point (32) | |||||||||
In_pos_neg_data | 354 | ||||||||
Description | Phenotype | WBPhenotype:0000010 | Paper_evidence | WBPaper00036766 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | unc-25 mutants were hypersensitive to fluoxetine in the paralysis assay. | Paper_evidence | WBPaper00036766 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00005058 | Paper_evidence | WBPaper00036766 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000016 | Paper_evidence | WBPaper00031872 | |||||||
WBPaper00035198 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | % animals paralyzed after 60 min on 1mM aldicarb was significantly higher than % N2 animals paralyzed. | Paper_evidence | WBPaper00031872 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00003650 | Paper_evidence | WBPaper00031872 | |||||
WBPaper00035198 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007833 | PATO:0001549 | Paper_evidence | WBPaper00031872 | ||||
WBPaper00035198 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000180 | Paper_evidence | WBPaper00006029 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 148/549 adult animals showed defects as visualized by unc-47::GFP. | Paper_evidence | WBPaper00006029 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004822 | PATO:0000460 | Paper_evidence | WBPaper00006029 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | oxIs12 | Paper_evidence | WBPaper00006029 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000229 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | slightly small | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000273 | Paper_evidence | WBPaper00035198 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibit reduced thrashing compared to wild-type animals; however, animals thrashed significantly more than unc-49(e407) mutants. | Paper_evidence | WBPaper00035198 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000380 | Paper_evidence | WBPaper00006029 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | % of animals with expulsions was significantly decreased compared to wild-type at all temperatures. | Paper_evidence | WBPaper00006029 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005803 | PATO:0000460 | Paper_evidence | WBPaper00006029 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 15, 20, 25 | Paper_evidence | WBPaper00006029 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000402 | Paper_evidence | WBPaper00056338 | |||||||
Curator_confirmed | WBPerson36360 | ||||||||
WBPhenotype:0000420 | Paper_evidence | WBPaper00031872 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | % animals paralyzed after 60 min on 200mM levamisole was significantly higher than % N2 animals paralyzed under same conditions. | Paper_evidence | WBPaper00031872 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Affected_by | Molecule | WBMol:00004019 | Paper_evidence | WBPaper00031872 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000552 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | deficient in GABA | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000563 | Paper_evidence | WBPaper00004889 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson2987 | |||||||||
Remark | shrinker, contracts both dorsally and ventrally when prodded | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Table I | Paper_evidence | WBPaper00004889 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000604 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | some neuroanatomical defects (D motorneurons) | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005409 | PATO:0000460 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000631 | Paper_evidence | WBPaper00035198 | |||||||
WBPaper00055158 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson8908 | |||||||||
Remark | Animals exhibit anterior convulsions when treated with pentylenetetrazole(PTZ). | Paper_evidence | WBPaper00035198 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Pentylenetetrazol-induced convulsions seen with these alleles | Paper_evidence | WBPaper00055158 | |||||||
Curator_confirmed | WBPerson8908 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00055158 | ||||||
Curator_confirmed | WBPerson8908 | ||||||||
Affected_by | Molecule | WBMol:00004251 | Paper_evidence | WBPaper00035198 | |||||
WBPaper00055158 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson8908 | |||||||||
Phenotype_assay | Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00055158 | |||||
Curator_confirmed | WBPerson8908 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00000031 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000646 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000662 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Fab | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000664 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000996 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Exp defect in defecation | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001005 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | poor backing | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001265 | Paper_evidence | WBPaper00042154 | |||||||
Curator_confirmed | WBPerson1455 | ||||||||
Remark | In free locomotion, head swing is irregular, and the irregularity increases remarkably with aging (Fig. 3 and Fig. 8D). | Paper_evidence | WBPaper00042154 | ||||||
Curator_confirmed | WBPerson1455 | ||||||||
WBPhenotype:0001524 | Paper_evidence | WBPaper00045634 | |||||||
Curator_confirmed | WBPerson13849 | ||||||||
Remark | decreased total quiescence | Paper_evidence | WBPaper00045634 | ||||||
Curator_confirmed | WBPerson13849 | ||||||||
WBPhenotype:0002159 | Paper_evidence | WBPaper00056338 | |||||||
Curator_confirmed | WBPerson36360 | ||||||||
WBPhenotype:0002490 | Paper_evidence | WBPaper00006029 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | 148/549 adult animals showed defects as visualized by unc-47::GFP. | Paper_evidence | WBPaper00006029 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004822 | PATO:0000460 | Paper_evidence | WBPaper00006029 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | oxIs12 | Paper_evidence | WBPaper00006029 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001645 | Paper_evidence | WBPaper00040284 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table S2 | Paper_evidence | WBPaper00040284 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Disease_info | Models_disease | DOID:1826 | |||||||
Models_disease_in_annotation | WBDOannot00000549 | ||||||||
Reference (23) | |||||||||
Method | Substitution_allele |