WormBase Tree Display for Variation: WBVar00090602
expand all nodes | collapse all nodes | view schema
WBVar00090602 | Evidence | Paper_evidence | WBPaper00003929 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | n2853 | |||||||
Sequence_details | SMap | S_parent | Sequence | C05G5 | |||||
Flanking_sequences | gtggacggtctacactgtggatccggtgag | tagtaggttgtatagtttggaatattacca | |||||||
Mapping_target | C05G5 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00003929 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00027302 | ||||||||
WBStrain00029077 | |||||||||
Laboratory | MT | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00002285 | |||||||
Transcript | C05G5.6 | ||||||||
Interactor (53) | |||||||||
Genetics | Interpolated_map_position | X | 21.2123 | ||||||
Description | Phenotype | WBPhenotype:0000033 | Paper_evidence | WBPaper00031335 | |||||
WBPaper00003929 | |||||||||
WBPaper00036739 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
WBPerson3490 | |||||||||
Remark (3) | |||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000038 | Paper_evidence | WBPaper00003929 | |||||||
WBPaper00029255 | |||||||||
WBPaper00034755 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark (2) | |||||||||
Temperature_sensitive | Heat_sensitive | 20 | Paper_evidence | WBPaper00034755 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000054 | Paper_evidence | WBPaper00031335 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Animals die as larvae | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000060 | Paper_evidence | WBPaper00003929 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | n2853 caused a temperature-sensitive adult lethal phenotype. | Paper_evidence | WBPaper00003929 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007833 | PATO:0001422 | Paper_evidence | WBPaper00003929 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00003929 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00003929 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000062 | Paper_evidence | WBPaper00031590 | |||||||
WBPaper00029255 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark (2) | |||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031590 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00031590 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000114 | Paper_evidence | WBPaper00032489 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | ugt-63 and vit-1 are differentially expressed in synchronized late L4 wild-type and let-7(n2853) animals but are not direct targets of let-7 (B Hurschler and HG, unpublished data); vit-1 was four-fold less abundant in let-7(n2853) than in wild-type animals, and ugt-63 was two-fold more abundant however, the translational profiles of both genes were similar in wild-type and let-7(n2853). | Paper_evidence | WBPaper00032489 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000038 | PATO:0000460 | Paper_evidence | WBPaper00032489 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000134 | Paper_evidence | WBPaper00036739 | |||||||
Curator_confirmed | WBPerson3490 | ||||||||
WBPhenotype:0000135 | Paper_evidence | WBPaper00003929 | |||||||
WBPaper00036739 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPerson3490 | |||||||||
Remark | The lacZ/lin-41 3' UTR fusion gene was expressed in 79% (n = 14) of let-7 (n2853) adult animals but only 19% (n = 21) of wild-type adults. While no major alterations in the timing or levels of LIN-14 (data not shown) or lin-28::GFP expression (V. Ambros, personal communication) were observed in let-7 mutant animals. | Paper_evidence | WBPaper00003929 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000136 | Paper_evidence | WBPaper00026761 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | A greater than 3-fold higher level of lin-41 in RNA samples were collected from let-7(n2853) compared to wild-type worms at the L4 stage. Relative lin-41 mRNA levels were indistinguishable between wild-type and let-7(n2853) worms at the L2 stage, which is prior to the onset of let-7 expression. The expression levels of con- trol mRNAs not predicted to be regulated by let-7, including eft-2, unc-54 and col-10, were indistinguishable in wild-type versus let-7(n2853) worms during larval development. | Paper_evidence | WBPaper00026761 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000167 | Paper_evidence | WBPaper00036739 | |||||||
Curator_confirmed | WBPerson3490 | ||||||||
WBPhenotype:0000170 | Paper_evidence | WBPaper00036739 | |||||||
Curator_confirmed | WBPerson3490 | ||||||||
WBPhenotype:0000438 | Paper_evidence | WBPaper00031590 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | No adult lateral alae were present in L4 (n=20) or 0% adults (n=20). | Paper_evidence | WBPaper00031590 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031590 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0007832 | PATO:0000460 | Paper_evidence | WBPaper00031590 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 15C | Paper_evidence | WBPaper00031590 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000638 | Paper_evidence | WBPaper00031590 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031590 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 15C | Paper_evidence | WBPaper00031590 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000640 | Paper_evidence | WBPaper00031590 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031590 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 15C | Paper_evidence | WBPaper00031590 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00031590 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals produced 2-5% fertile eggs (n>100). | Paper_evidence | WBPaper00031590 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031590 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00031590 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000962 | Paper_evidence | WBPaper00034755 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | X-Gal staining of let-7(n2853) adult animals was unchanged from larval levels (98%, n = 359, normalized to stained larvae), unlike controls. | Paper_evidence | WBPaper00034755 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Haplo_insufficient | Paper_evidence | WBPaper00034755 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | mgEx540[Pcol-10::Lac-Z::lin-41-3'UTR] | Paper_evidence | WBPaper00034755 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001228 | Paper_evidence | WBPaper00003929 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | n2853 mutants failed to generate alae. | Paper_evidence | WBPaper00003929 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001236 | Paper_evidence | WBPaper00042320 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | hbl-1::gfp::hbl-1 in VNC and col-10::gfp::lin-41 (3'UTR) in hypodermal cells had elevated expression. This elevated expression was not affected by loss of autophagy activity. | Paper_evidence | WBPaper00042320 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001431 | Paper_evidence | WBPaper00027716 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Penetrance | Range | 59 | 59 | Paper_evidence | WBPaper00027716 | ||||
Curator_confirmed | WBPerson48 | ||||||||
Phenotype_assay | Temperature | 15 | Paper_evidence | WBPaper00027716 | |||||
Curator_confirmed | WBPerson48 | ||||||||
Genotype | n2853; him-5(e1490) | Paper_evidence | WBPaper00027716 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0001779 | Paper_evidence | WBPaper00026761 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | The n2853 mutation results in significantly lower levels of the mature let-7 miRNA; Northern analyses showed that let-7 levels at the L4 stage in the mutant were lower by over 3-fold at 15C and over 10-fold at 25C compared to wild-type. | Paper_evidence | WBPaper00026761 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001801 | Paper_evidence | WBPaper00056872 | |||||||
Curator_confirmed | WBPerson26767 | ||||||||
Remark | axodendritic polarity of DA9 neuron variant | Paper_evidence | WBPaper00056872 | ||||||
Curator_confirmed | WBPerson26767 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004857 | PATO:0000460 | Paper_evidence | WBPaper00056872 | ||||
Curator_confirmed | WBPerson26767 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00056872 | ||||||
Curator_confirmed | WBPerson26767 | ||||||||
Phenotype_assay | Genotype | wyIs85 [Pitr-1-pB::GFP::RAB-3] | Paper_evidence | WBPaper00056872 | |||||
Curator_confirmed | WBPerson26767 | ||||||||
WBPhenotype:0001887 | Paper_evidence | WBPaper00034755 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | In let-7(n2853) animals, seam cells reiterate the late larval fate of cell division at the L4-to-adult molt, which leads to an increased number of seam cells. let- 7(n2853) animals after the L4-to-adult molt displayed ~22.3 seam cell nuclei (n = 110) on average. | Paper_evidence | WBPaper00034755 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Haplo_insufficient | Paper_evidence | WBPaper00034755 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002154 | Paper_evidence | WBPaper00032489 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Both lin-41 and daf-12 mRNAs were moderately, but consistently depleted from the highly translated polysomal fractions in wild-type relative to let-7 mutant animals at the late L4 stage. By contrast, ama-1 and act-1 mRNAs, which are not targeted by let-7, displayed similar translational profiles in both strains. 40% of reporter mRNA was associated with polysomes in wild-type animals, whereas this level reached almost 70% in let-7 mutant animals. Consistent with inhibition of translation initiation, we observed that only 40% of the reporter mRNA was associated with polysomes in wild-type animals, whereas this level reached almost 70% in let-7 mutant animals. The let-7 mutation increased the average number of ribosomes per lacZ mRNA by more than two-fold relative to the wild-type situation. | Paper_evidence | WBPaper00032489 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Rescued_by_transgene | WBTransgene00005568 | ||||||||
WBPhenotype:0002157 | Paper_evidence | WBPaper00032489 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | At the late L4 stage, lin-41 mRNA is six-fold and daf-12 two-fold more abundant in let-7(n2853) relative to wild-type animals, but not at the L3 stage. | Paper_evidence | WBPaper00032489 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000038 | PATO:0000460 | Paper_evidence | WBPaper00032489 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002479 | Paper_evidence | WBPaper00042278 | |||||||
Curator_confirmed | WBPerson17616 | ||||||||
Phenotype_not_observed | WBPhenotype:0000207 | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Defecation cycle is normal | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000634 | Paper_evidence | WBPaper00031335 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Pumping is normal | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000637 | Paper_evidence | WBPaper00031335 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | No defects in dauer formation | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000643 | Paper_evidence | WBPaper00031335 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | non-Unc | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001233 | Paper_evidence | WBPaper00031335 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Cell number and nuclear staining is normal | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | DAPI staining | Paper_evidence | WBPaper00031335 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0002535 | Paper_evidence | WBPaper00031335 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | non-Dyf | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005666 | PATO:0000460 | Paper_evidence | WBPaper00031335 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0005667 | PATO:0000460 | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0005668 | PATO:0000460 | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0005665 | PATO:0000460 | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0005661 | PATO:0000460 | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0007807 | PATO:0000460 | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBbt:0007808 | PATO:0000460 | Paper_evidence | WBPaper00031335 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | DiO staining | Paper_evidence | WBPaper00031335 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference (18) | |||||||||
Remark | |||||||||
Method | Substitution_allele |