WormBase Tree Display for Variation: WBVar00088026
expand all nodes | collapse all nodes | view schema
| WBVar00088026 | Evidence | Paper_evidence | WBPaper00005079 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Name | Public_name | it55 | |||||||
| Other_name | M117.2a.4:c.146C>T | ||||||||
| M117.2a.3:c.146C>T | |||||||||
| M117.2a.2:c.146C>T | |||||||||
| CE06200:p.Ala49Val | |||||||||
| M117.2a.1:c.146C>T | |||||||||
| HGVSg | CHROMOSOME_IV:g.11821704G>A | ||||||||
| Sequence_details | SMap | S_parent | Sequence | M117 | |||||
| Flanking_sequences | ccaacgaagagcgtaaccttctctctgttg | ctacaaaaacgtcgtcggagctcgccgttc | |||||||
| Mapping_target | M117 | ||||||||
| Type_of_mutation | Substitution | c | t | ||||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00023556 | ||||||||
| Laboratory | KK | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00003920 | |||||||
| Transcript | M117.2a.1 (12) | ||||||||
| M117.2a.2 (12) | |||||||||
| M117.2a.3 (12) | |||||||||
| M117.2a.4 (12) | |||||||||
| Interactor | WBInteraction000501507 | ||||||||
| WBInteraction000501759 | |||||||||
| WBInteraction000501975 | |||||||||
| WBInteraction000517380 | |||||||||
| WBInteraction000523956 | |||||||||
| WBInteraction000541634 | |||||||||
| WBInteraction000541710 | |||||||||
| WBInteraction000541711 | |||||||||
| WBInteraction000541712 | |||||||||
| WBInteraction000542349 | |||||||||
| Genetics (2) | |||||||||
| Description | Phenotype | WBPhenotype:0000034 | Paper_evidence | WBPaper00005079 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | MEX-5 (an early marker of embryonic polarity) fails to properly localize to the anterior pole of the zygote | Paper_evidence | WBPaper00005079 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Penetrance | Incomplete | 72 percent | Paper_evidence | WBPaper00005079 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00005079 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00005079 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Maternal | Strictly_maternal | Paper_evidence | WBPaper00005079 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_assay | Treatment | Staining with MEX-5 antibody | Paper_evidence | WBPaper00005079 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0000052 | Paper_evidence | WBPaper00005079 | |||||||
| Person_evidence | WBPerson261 | ||||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPerson712 | |||||||||
| Remark | Mutants exhibit a highly penetrant Emb phenotype at all tested temperatures | Paper_evidence | WBPaper00005079 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| maternal effect lethal | Person_evidence | WBPerson261 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Penetrance | High | Paper_evidence | WBPaper00005079 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Range | 97 | 100 | Paper_evidence | WBPaper00005079 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00005079 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00005079 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Maternal | Strictly_maternal | Paper_evidence | WBPaper00005079 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_assay | Temperature | 15C, 20C, 25C | Paper_evidence | WBPaper00005079 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Genotype | unc-22(e66), dpy-20(e1282) | Paper_evidence | WBPaper00005079 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0000120 | Paper_evidence | WBPaper00005079 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | The levels of posterior proteins PAR-1 and PAR-2 at the cortex appear reduced relative to wild-type | Paper_evidence | WBPaper00005079 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00005079 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00005079 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Maternal | Strictly_maternal | Paper_evidence | WBPaper00005079 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_assay | Treatment | Staining with PAR1 and PAR-2 antibodies | Paper_evidence | WBPaper00005079 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0000425 | Paper_evidence | WBPaper00005079 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | MEX-5 staining in par-5 mutants is significantly reduced compared to wild-type | Paper_evidence | WBPaper00005079 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Penetrance | Incomplete | 72 percent | Paper_evidence | WBPaper00005079 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00005079 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00005079 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Maternal | Strictly_maternal | Paper_evidence | WBPaper00005079 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_assay | Treatment | Staining with MEX-5 antibody | Paper_evidence | WBPaper00005079 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0000436 | Paper_evidence | WBPaper00005079 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | In par-5 mutants, anterior group proteins (PAR-3, PAR-6 and PKC-3) and posterior group proteins (PAR-1 and PAR-2) are not restricted to their respective poles. In contrast to wild-type, the boundaries of the anterior and posterior proteins overlap considerably | Paper_evidence | WBPaper00005079 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Penetrance | High | Paper_evidence | WBPaper00005079 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Range | 88 | 95 | Paper_evidence | WBPaper00005079 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00005079 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00005079 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Maternal | Strictly_maternal | Paper_evidence | WBPaper00005079 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_assay | Treatment | Staining with PAR1, PAR-2, PAR-3, PAR-6 and PKC-3 antibodies | Paper_evidence | WBPaper00005079 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0000706 | Person_evidence | WBPerson261 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | most embryos lack gut granules | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0000707 | Paper_evidence | WBPaper00005079 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | Some embryos lack staining to pharyngeal myosin | Paper_evidence | WBPaper00005079 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Penetrance | Incomplete | 36 percent | Paper_evidence | WBPaper00005079 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00005079 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00005079 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Maternal | Strictly_maternal | Paper_evidence | WBPaper00005079 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_assay | Treatment | Staining with pharyngeal myosin antibody | Paper_evidence | WBPaper00005079 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0000748 | Paper_evidence | WBPaper00005079 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | The daughter cells following first cleavage are more similar in size to each other than are wild-type blastomeres | Paper_evidence | WBPaper00005079 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00005079 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00005079 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Maternal | Strictly_maternal | Paper_evidence | WBPaper00005079 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0000760 | Person_evidence | WBPerson261 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | 2nd cleavage spindles transverse | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001105 | Paper_evidence | WBPaper00005079 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | The first cleavage spindle was misoriented in some embryos (offset from the long axis of the egg by > 45 degrees) | Paper_evidence | WBPaper00005079 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Penetrance | Incomplete | 35 percent | Paper_evidence | WBPaper00005079 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00005079 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00005079 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Maternal | Strictly_maternal | Paper_evidence | WBPaper00005079 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0001106 | Paper_evidence | WBPaper00005079 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | The cleavage spindle orientations in par-5 blastomeres are variable (either the anterior or the posterior spindle elongated at angles up to 45 degrees with respect to the short axis of the embryo) | Paper_evidence | WBPaper00005079 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00005079 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00005079 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Maternal | Strictly_maternal | Paper_evidence | WBPaper00005079 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0001110 | Person_evidence | WBPerson261 | |||||||
| Curator_confirmed | WBPerson712 | ||||||||
| Remark | asters spherical (resembles Par-2) | Person_evidence | WBPerson261 | ||||||
| Curator_confirmed | WBPerson712 | ||||||||
| WBPhenotype:0001120 | Paper_evidence | WBPaper00005079 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | In contrast to the wild-type division sequence, early blastomeres cleave synchronously up to the third cleavage | Paper_evidence | WBPaper00005079 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00005079 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00005079 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Maternal | Strictly_maternal | Paper_evidence | WBPaper00005079 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0001123 | Paper_evidence | WBPaper00005079 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | AB and P1 divide synchronously | Paper_evidence | WBPaper00005079 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00005079 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00005079 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Maternal | Strictly_maternal | Paper_evidence | WBPaper00005079 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0001155 | Paper_evidence | WBPaper00005079 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | Pronuclear meeting in par-5 mutant embryos occurs on average more medially than in wild-type | Paper_evidence | WBPaper00005079 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00005079 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00005079 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Maternal | Strictly_maternal | Paper_evidence | WBPaper00005079 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0001169 | Paper_evidence | WBPaper00005079 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | The pseudocleavage furrow in par-5 embryos is often deeper than in wild-type. In some cases, the pseudocleavage furrow persists longer than in wild-type, remaining even after pronuclear migration | Paper_evidence | WBPaper00005079 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00005079 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00005079 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Maternal | Strictly_maternal | Paper_evidence | WBPaper00005079 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0001259 | Paper_evidence | WBPaper00005079 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | it55 hermaphrodites show reduced fecundity than control animals | Paper_evidence | WBPaper00005079 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00005079 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00005079 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Maternal | Strictly_maternal | Paper_evidence | WBPaper00005079 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_assay | Temperature | 15C, 20C, 25C | Paper_evidence | WBPaper00005079 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Genotype | unc-22(e66), dpy-20(e1282) | Paper_evidence | WBPaper00005079 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0001302 | Paper_evidence | WBPaper00005079 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | In contrast to wild-type, the P granules in par-5 embryos are not completely restricted to the posterior end | Paper_evidence | WBPaper00005079 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Penetrance | High | 91 percent | Paper_evidence | WBPaper00005079 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00005079 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00005079 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Maternal | Strictly_maternal | Paper_evidence | WBPaper00005079 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_assay | Treatment | Staining with P-granule antibody | Paper_evidence | WBPaper00005079 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0001504 | Paper_evidence | WBPaper00005079 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | Almost all surviving adult progeny are sterile at each tested temperatures | Paper_evidence | WBPaper00005079 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Penetrance | High | At 15C and 20C, 100 percent of surviving adult progeny are sterile | Paper_evidence | WBPaper00005079 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00005079 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00005079 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Maternal | Strictly_maternal | Paper_evidence | WBPaper00005079 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_assay | Temperature | 15C, 20C | Paper_evidence | WBPaper00005079 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Genotype | unc-22(e66), dpy-20(e1282) | Paper_evidence | WBPaper00005079 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0001637 | Paper_evidence | WBPaper00005079 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | Some embryos lack intestinal birefringence | Paper_evidence | WBPaper00005079 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Penetrance | High | 93 percent | Paper_evidence | WBPaper00005079 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00005079 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00005079 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Maternal | Strictly_maternal | Paper_evidence | WBPaper00005079 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0001642 | Paper_evidence | WBPaper00005079 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | P1 blastomere divides transversely, like wild-type AB | Paper_evidence | WBPaper00005079 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Penetrance | Complete | 100 percent | Paper_evidence | WBPaper00005079 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00005079 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00005079 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Maternal | Strictly_maternal | Paper_evidence | WBPaper00005079 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Reference | WBPaper00013871 | ||||||||
| WBPaper00005079 | |||||||||
| WBPaper00014102 | |||||||||
| WBPaper00013870 | |||||||||
| WBPaper00018985 | |||||||||
| Method | Substitution_allele |
